Incidental Mutation 'R3852:Lrrc8a'
ID275947
Institutional Source Beutler Lab
Gene Symbol Lrrc8a
Ensembl Gene ENSMUSG00000007476
Gene Nameleucine rich repeat containing 8A
SynonymsLrrc8
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30237715-30263790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30261960 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 757 (T757M)
Ref Sequence ENSEMBL: ENSMUSP00000139038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091132] [ENSMUST00000095078] [ENSMUST00000113643] [ENSMUST00000113645] [ENSMUST00000113654] [ENSMUST00000127689] [ENSMUST00000133877] [ENSMUST00000138254] [ENSMUST00000139454] [ENSMUST00000139719] [ENSMUST00000150695] [ENSMUST00000154647]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085290
Predicted Effect probably benign
Transcript: ENSMUST00000091132
SMART Domains Protein: ENSMUSP00000088663
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 32 279 2.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095078
AA Change: T757M

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: T757M

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 340 1.4e-146 PFAM
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113643
SMART Domains Protein: ENSMUSP00000109273
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 238 9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113645
SMART Domains Protein: ENSMUSP00000109275
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113654
AA Change: T757M

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: T757M

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127689
SMART Domains Protein: ENSMUSP00000119543
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 150 7.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133877
SMART Domains Protein: ENSMUSP00000117643
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 8 249 9.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138254
SMART Domains Protein: ENSMUSP00000116062
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 157 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139454
AA Change: T757M

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: T757M

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139719
SMART Domains Protein: ENSMUSP00000116450
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 217 4.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150695
SMART Domains Protein: ENSMUSP00000121995
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 107 1.1e-16 PFAM
Pfam:PhyH 104 212 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154647
SMART Domains Protein: ENSMUSP00000121371
Gene: ENSMUSG00000079484

DomainStartEndE-ValueType
Pfam:PhyH 12 259 1.4e-73 PFAM
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Lrrc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Lrrc8a APN 2 30255315 missense probably benign 0.32
IGL01161:Lrrc8a APN 2 30255810 missense probably damaging 1.00
IGL01419:Lrrc8a APN 2 30257099 missense probably benign 0.09
IGL01757:Lrrc8a APN 2 30255525 missense possibly damaging 0.81
IGL02390:Lrrc8a APN 2 30256701 missense probably damaging 1.00
IGL02608:Lrrc8a APN 2 30256299 missense possibly damaging 0.91
IGL02938:Lrrc8a APN 2 30255686 missense probably damaging 1.00
IGL02960:Lrrc8a APN 2 30257013 missense probably damaging 1.00
IGL03139:Lrrc8a APN 2 30255671 missense probably damaging 1.00
IGL03166:Lrrc8a APN 2 30255365 missense probably benign
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0276:Lrrc8a UTSW 2 30256788 missense possibly damaging 0.54
R0432:Lrrc8a UTSW 2 30257067 missense probably damaging 1.00
R0751:Lrrc8a UTSW 2 30256350 missense possibly damaging 0.82
R1924:Lrrc8a UTSW 2 30255250 missense probably damaging 1.00
R2029:Lrrc8a UTSW 2 30256649 missense probably damaging 1.00
R4898:Lrrc8a UTSW 2 30257202 missense probably benign 0.00
R5175:Lrrc8a UTSW 2 30255512 missense probably damaging 1.00
R5616:Lrrc8a UTSW 2 30255354 missense probably benign 0.09
R5874:Lrrc8a UTSW 2 30257136 missense probably damaging 1.00
R6228:Lrrc8a UTSW 2 30256553 missense possibly damaging 0.82
R6406:Lrrc8a UTSW 2 30257091 missense possibly damaging 0.56
R6456:Lrrc8a UTSW 2 30255474 missense probably benign 0.14
R6833:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6834:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6945:Lrrc8a UTSW 2 30256227 missense probably damaging 1.00
R7675:Lrrc8a UTSW 2 30255668 missense probably damaging 1.00
Z1177:Lrrc8a UTSW 2 30256313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGAAAGCCCTGTCCAGC -3'
(R):5'- TAGTCTCAGAGGTTCTGGTCTC -3'

Sequencing Primer
(F):5'- AAGCCCTGTCCAGCCATGC -3'
(R):5'- GTCTCCAGCAAGTGCCTGTC -3'
Posted On2015-04-06