Mutagenetix > Incidental Mutation

Incidental Mutation 'R3852:Dpysl4'

275974

Institutional Source

Beutler Lab

Gene Symbol

Dpysl4

Ensembl Gene

ENSMUSG00000025478

Gene Name

dihydropyrimidinase-like 4

Synonyms

Drp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4

MMRRC Submission

040784-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R3852 (G1)

Quality Score

186

Status

Validated

Chromosome

Chromosomal Location

139086001-139102704 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 139100935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 575 (T575M)

Ref Sequence

ENSEMBL: ENSMUSP00000112896 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000165870]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000016125

SMART Domains

Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	32	48	N/A	INTRINSIC
low complexity region	62	80	N/A	INTRINSIC
S_TKc	94	354	9.16e-82	SMART
low complexity region	398	407	N/A	INTRINSIC
low complexity region	408	418	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000026551
AA Change: T554M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: T554M

Domain	Start	End	E-Value	Type
Pfam:Amidohydro_1	64	453	4.5e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121184
AA Change: T575M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: T575M

Domain	Start	End	E-Value	Type
Pfam:Amidohydro_1	85	474	1.1e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122844

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154273

Predicted Effect

probably benign
Transcript: ENSMUST00000165870

SMART Domains

Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	232	1.2e-30	PFAM
Pfam:Pkinase	1	235	1.5e-51	PFAM
Pfam:Kinase-like	12	223	6.2e-13	PFAM
low complexity region	280	289	N/A	INTRINSIC
low complexity region	290	300	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

96% (45/47)

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	T	C	16: 20,560,439	V685A	probably damaging	Het
Abhd4	T	C	14: 54,265,367	Y44H	probably damaging	Het
AI429214	A	G	8: 36,994,442	D248G	probably damaging	Het
AY358078	A	G	14: 51,805,553	T233A	unknown	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Ccdc34	A	G	2: 110,032,428	K193E	possibly damaging	Het
Dhcr24	A	G	4: 106,573,873	E253G	probably benign	Het
Dnah6	A	G	6: 73,127,927	V1841A	possibly damaging	Het
Dpp10	A	T	1: 123,485,924	Y186*	probably null	Het
Dusp7	T	A	9: 106,373,893	S406T	probably benign	Het
Gga3	T	A	11: 115,587,542	T475S	probably benign	Het
Gm10271	T	A	10: 116,956,874	K36*	probably null	Het
Gm572	G	A	4: 148,668,872	E325K	possibly damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
Igf1	A	T	10: 87,915,319	K126*	probably null	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Klhl1	A	T	14: 96,280,205	M345K	probably benign	Het
Lrp2	A	G	2: 69,537,565	V201A	probably damaging	Het
Lrrc8a	C	T	2: 30,261,960	T757M	probably benign	Het
Mios	T	A	6: 8,216,453	I459K	probably benign	Het
Mrps11	T	C	7: 78,790,645	I94T	probably damaging	Het
Ms4a4c	T	A	19: 11,416,395	S68T	probably benign	Het
Mstn	C	T	1: 53,061,971	T69I	possibly damaging	Het
Myo10	A	G	15: 25,779,626	K28E	probably damaging	Het
Nol6	A	G	4: 41,117,452	S914P	probably damaging	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr547	C	A	7: 102,535,280	H178N	probably benign	Het
Olfr585	T	C	7: 103,098,184	S148P	probably damaging	Het
Pcdh17	C	T	14: 84,447,259	Q389*	probably null	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Prr14l	T	C	5: 32,830,345	E602G	probably damaging	Het
Rusc2	C	A	4: 43,416,424	Q577K	probably benign	Het
Sacm1l	T	A	9: 123,587,576	M534K	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Tas2r104	A	T	6: 131,684,925	C274S	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim43c	T	A	9: 88,840,401	H33Q	probably damaging	Het
Ttc17	A	T	2: 94,369,413	I411K	possibly damaging	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Ttn	A	C	2: 76,955,024	V669G	possibly damaging	Het
Vmn1r60	A	T	7: 5,545,027	F25I	possibly damaging	Het
Vmn2r9	A	G	5: 108,848,131	I217T	probably damaging	Het

Other mutations in Dpysl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Dpysl4	APN	7	139096176	missense	probably damaging	1.00
IGL01836:Dpysl4	APN	7	139096173	missense	possibly damaging	0.96
IGL02447:Dpysl4	APN	7	139098600	missense	probably damaging	1.00
IGL02515:Dpysl4	APN	7	139096735	missense	probably damaging	1.00
IGL03169:Dpysl4	APN	7	139099910	splice site	probably null
PIT4382001:Dpysl4	UTSW	7	139089578	nonsense	probably null
R0012:Dpysl4	UTSW	7	139097883	missense	probably benign	0.32
R0012:Dpysl4	UTSW	7	139097883	missense	probably benign	0.32
R1624:Dpysl4	UTSW	7	139089553	missense	probably damaging	1.00
R1642:Dpysl4	UTSW	7	139090338	missense	probably damaging	1.00
R1860:Dpysl4	UTSW	7	139090299	missense	probably benign
R1885:Dpysl4	UTSW	7	139096807	missense	probably damaging	1.00
R1995:Dpysl4	UTSW	7	139096770	missense	probably benign
R2698:Dpysl4	UTSW	7	139096765	missense	probably damaging	1.00
R3032:Dpysl4	UTSW	7	139096236	missense	probably benign	0.01
R3762:Dpysl4	UTSW	7	139096756	missense	probably damaging	1.00
R3851:Dpysl4	UTSW	7	139100935	missense	probably damaging	1.00
R4609:Dpysl4	UTSW	7	139098621	missense	probably damaging	0.99
R4972:Dpysl4	UTSW	7	139090290	missense	probably damaging	1.00
R5538:Dpysl4	UTSW	7	139091990	missense	probably benign
R5608:Dpysl4	UTSW	7	139098543	missense	probably damaging	0.97
R5762:Dpysl4	UTSW	7	139091937	missense	probably benign
R5887:Dpysl4	UTSW	7	139096276	missense	possibly damaging	0.72
R6022:Dpysl4	UTSW	7	139086084	unclassified	probably benign
R6060:Dpysl4	UTSW	7	139089408	start codon destroyed	probably null
R6180:Dpysl4	UTSW	7	139090334	missense	probably damaging	1.00
R6328:Dpysl4	UTSW	7	139099818	missense	probably benign
R6809:Dpysl4	UTSW	7	139093660	missense	probably benign	0.19
R6949:Dpysl4	UTSW	7	139091999	missense	probably damaging	1.00
R7647:Dpysl4	UTSW	7	139099773	missense	possibly damaging	0.92
R7695:Dpysl4	UTSW	7	139086123	start codon destroyed	probably null	0.00
R7751:Dpysl4	UTSW	7	139089540	missense	probably benign
R8129:Dpysl4	UTSW	7	139086160	missense	probably benign	0.04
R9538:Dpysl4	UTSW	7	139090314	missense	probably damaging	1.00
Z1189:Dpysl4	UTSW	7	139089408	start codon destroyed	probably null
Z1192:Dpysl4	UTSW	7	139089408	start codon destroyed	probably null

Predicted Primers

PCR Primer
(F):5'- ATTGCCTTAGGGATGAGCAG -3'
(R):5'- GTAAGGCTGAGCACCTTTCAC -3'

Sequencing Primer
(F):5'- CTTAGGGATGAGCAGGCTTCC -3'
(R):5'- GGCTGAGCACCTTTCACAATAAC -3'

Posted On

2015-04-06