Incidental Mutation 'R3852:Dpysl4'
ID275974
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Namedihydropyrimidinase-like 4
SynonymsDrp-4, Ulip4, Crmp3, CRMP-3, unc-33-like phosphoprotein 4, DPY4
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3852 (G1)
Quality Score186
Status Validated
Chromosome7
Chromosomal Location139086001-139102704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139100935 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 575 (T575M)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016125] [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000165870]
Predicted Effect probably benign
Transcript: ENSMUST00000016125
SMART Domains Protein: ENSMUSP00000016125
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
low complexity region 62 80 N/A INTRINSIC
S_TKc 94 354 9.16e-82 SMART
low complexity region 398 407 N/A INTRINSIC
low complexity region 408 418 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000026551
AA Change: T554M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: T554M

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121184
AA Change: T575M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: T575M

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154273
Predicted Effect probably benign
Transcript: ENSMUST00000165870
SMART Domains Protein: ENSMUSP00000126638
Gene: ENSMUSG00000015981

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 232 1.2e-30 PFAM
Pfam:Pkinase 1 235 1.5e-51 PFAM
Pfam:Kinase-like 12 223 6.2e-13 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 290 300 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Nol6 A G 4: 41,117,452 S914P probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 139096176 missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 139096173 missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 139098600 missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 139096735 missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 139099910 splice site probably null
PIT4382001:Dpysl4 UTSW 7 139089578 nonsense probably null
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R0012:Dpysl4 UTSW 7 139097883 missense probably benign 0.32
R1624:Dpysl4 UTSW 7 139089553 missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 139090338 missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 139090299 missense probably benign
R1885:Dpysl4 UTSW 7 139096807 missense probably damaging 1.00
R1995:Dpysl4 UTSW 7 139096770 missense probably benign
R2698:Dpysl4 UTSW 7 139096765 missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 139096236 missense probably benign 0.01
R3762:Dpysl4 UTSW 7 139096756 missense probably damaging 1.00
R3851:Dpysl4 UTSW 7 139100935 missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 139098621 missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 139090290 missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 139091990 missense probably benign
R5608:Dpysl4 UTSW 7 139098543 missense probably damaging 0.97
R5762:Dpysl4 UTSW 7 139091937 missense probably benign
R5887:Dpysl4 UTSW 7 139096276 missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 139086084 unclassified probably benign
R6060:Dpysl4 UTSW 7 139089408 start codon destroyed probably null
R6180:Dpysl4 UTSW 7 139090334 missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 139099818 missense probably benign
R6809:Dpysl4 UTSW 7 139093660 missense probably benign 0.19
R6949:Dpysl4 UTSW 7 139091999 missense probably damaging 1.00
R7647:Dpysl4 UTSW 7 139099773 missense possibly damaging 0.92
R7695:Dpysl4 UTSW 7 139086123 start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 139089540 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCCTTAGGGATGAGCAG -3'
(R):5'- GTAAGGCTGAGCACCTTTCAC -3'

Sequencing Primer
(F):5'- CTTAGGGATGAGCAGGCTTCC -3'
(R):5'- GGCTGAGCACCTTTCACAATAAC -3'
Posted On2015-04-06