Incidental Mutation 'R3852:Nol6'
ID275956
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Namenucleolar protein family 6 (RNA-associated)
SynonymsNrap
MMRRC Submission 040784-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R3852 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41114427-41124455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41117452 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 914 (S914P)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
Predicted Effect probably damaging
Transcript: ENSMUST00000030138
AA Change: S914P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: S914P

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155315
Meta Mutation Damage Score 0.5932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,560,439 V685A probably damaging Het
Abhd4 T C 14: 54,265,367 Y44H probably damaging Het
AI429214 A G 8: 36,994,442 D248G probably damaging Het
AY358078 A G 14: 51,805,553 T233A unknown Het
Calcr T C 6: 3,693,735 Y353C probably damaging Het
Ccdc34 A G 2: 110,032,428 K193E possibly damaging Het
Dhcr24 A G 4: 106,573,873 E253G probably benign Het
Dnah6 A G 6: 73,127,927 V1841A possibly damaging Het
Dpp10 A T 1: 123,485,924 Y186* probably null Het
Dpysl4 C T 7: 139,100,935 T575M probably damaging Het
Dusp7 T A 9: 106,373,893 S406T probably benign Het
Gga3 T A 11: 115,587,542 T475S probably benign Het
Gm10271 T A 10: 116,956,874 K36* probably null Het
Gm572 G A 4: 148,668,872 E325K possibly damaging Het
Golga2 A G 2: 32,305,611 E806G probably benign Het
Igf1 A T 10: 87,915,319 K126* probably null Het
Itpkc A T 7: 27,227,612 N292K probably benign Het
Klhl1 A T 14: 96,280,205 M345K probably benign Het
Lrp2 A G 2: 69,537,565 V201A probably damaging Het
Lrrc8a C T 2: 30,261,960 T757M probably benign Het
Mios T A 6: 8,216,453 I459K probably benign Het
Mrps11 T C 7: 78,790,645 I94T probably damaging Het
Ms4a4c T A 19: 11,416,395 S68T probably benign Het
Mstn C T 1: 53,061,971 T69I possibly damaging Het
Myo10 A G 15: 25,779,626 K28E probably damaging Het
Ntn1 C G 11: 68,385,793 D110H probably damaging Het
Olfr547 C A 7: 102,535,280 H178N probably benign Het
Olfr585 T C 7: 103,098,184 S148P probably damaging Het
Pcdh17 C T 14: 84,447,259 Q389* probably null Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Prr14l T C 5: 32,830,345 E602G probably damaging Het
Rusc2 C A 4: 43,416,424 Q577K probably benign Het
Sacm1l T A 9: 123,587,576 M534K probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco4a1 C T 2: 180,464,091 T22M probably benign Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Tas2r104 A T 6: 131,684,925 C274S probably benign Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Trim43c T A 9: 88,840,401 H33Q probably damaging Het
Ttc17 A T 2: 94,369,413 I411K possibly damaging Het
Ttn G T 2: 76,751,334 L23072I possibly damaging Het
Ttn A C 2: 76,955,024 V669G possibly damaging Het
Vmn1r60 A T 7: 5,545,027 F25I possibly damaging Het
Vmn2r9 A G 5: 108,848,131 I217T probably damaging Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41123374 missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41122198 missense probably benign 0.10
IGL01062:Nol6 APN 4 41118205 missense probably benign 0.13
IGL01113:Nol6 APN 4 41115749 missense probably damaging 1.00
IGL01874:Nol6 APN 4 41115412 missense probably damaging 1.00
IGL01995:Nol6 APN 4 41118567 missense probably damaging 1.00
IGL02060:Nol6 APN 4 41117700 missense probably damaging 1.00
IGL03082:Nol6 APN 4 41115878 splice site probably benign
IGL03221:Nol6 APN 4 41124166 missense probably benign 0.00
IGL03332:Nol6 APN 4 41120735 missense probably damaging 1.00
leaky UTSW 4 41118154 missense probably benign 0.02
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0308:Nol6 UTSW 4 41123584 missense probably benign 0.01
R0632:Nol6 UTSW 4 41121115 missense probably damaging 0.96
R1222:Nol6 UTSW 4 41120760 missense probably benign 0.01
R1471:Nol6 UTSW 4 41120281 missense probably benign 0.00
R1481:Nol6 UTSW 4 41123596 missense probably benign 0.00
R1971:Nol6 UTSW 4 41119542 missense probably damaging 1.00
R2191:Nol6 UTSW 4 41118720 missense probably benign 0.00
R2495:Nol6 UTSW 4 41118427 missense probably damaging 1.00
R3923:Nol6 UTSW 4 41121531 missense probably benign 0.17
R4458:Nol6 UTSW 4 41115888 missense probably damaging 1.00
R4510:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4511:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4575:Nol6 UTSW 4 41120299 missense probably benign 0.00
R4637:Nol6 UTSW 4 41121788 missense probably damaging 0.99
R4700:Nol6 UTSW 4 41118944 missense possibly damaging 0.58
R4820:Nol6 UTSW 4 41121508 missense probably damaging 1.00
R4975:Nol6 UTSW 4 41120167 missense probably benign 0.00
R5395:Nol6 UTSW 4 41118392 intron probably benign
R5826:Nol6 UTSW 4 41122158 missense probably benign 0.04
R6531:Nol6 UTSW 4 41118154 missense probably benign 0.02
R6943:Nol6 UTSW 4 41118962 missense probably damaging 1.00
R7001:Nol6 UTSW 4 41121279 missense probably benign 0.00
R7035:Nol6 UTSW 4 41118479 missense probably benign 0.01
R7282:Nol6 UTSW 4 41119468 missense probably benign 0.18
R7327:Nol6 UTSW 4 41116686 missense probably benign 0.34
R7402:Nol6 UTSW 4 41118699 missense probably damaging 1.00
R7483:Nol6 UTSW 4 41117424 missense possibly damaging 0.92
R7505:Nol6 UTSW 4 41120352 missense probably damaging 1.00
R7669:Nol6 UTSW 4 41118717 missense probably damaging 0.97
R8255:Nol6 UTSW 4 41120168 missense probably benign 0.01
R8401:Nol6 UTSW 4 41119548 missense possibly damaging 0.87
R8426:Nol6 UTSW 4 41119870 missense probably benign 0.36
R8826:Nol6 UTSW 4 41121823 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAGGCTTAGACATCTGGGATCTAGG -3'
(R):5'- TTCACCCCTCCCAGGTAATG -3'

Sequencing Primer
(F):5'- AGACATCTGGGATCTAGGAGGCTTC -3'
(R):5'- CGCTCGGGAAGTTGCTCTAAG -3'
Posted On2015-04-06