Incidental Mutation 'R3895:Unc13c'
ID310503
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 040806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3895 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73933523 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 15 (H15Q)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: H15Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: H15Q

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: H15Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: H15Q

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T C 2: 127,972,525 probably benign Het
C6 T C 15: 4,808,470 V854A probably benign Het
Ccnd1 T C 7: 144,937,894 E136G probably damaging Het
CK137956 A T 4: 127,946,648 F422I probably benign Het
Csta1 T C 16: 36,131,032 T7A probably benign Het
Dock8 A G 19: 25,051,501 E23G probably benign Het
Fbxo8 A T 8: 56,591,521 R286S probably damaging Het
Gm12258 T G 11: 58,858,549 Y183* probably null Het
Gm4759 T A 7: 106,423,414 H127L probably damaging Het
Hectd3 A G 4: 116,996,089 D171G probably damaging Het
Hoxd11 C T 2: 74,682,792 R134W probably damaging Het
Ighg2c T C 12: 113,287,658 T246A unknown Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Lrp4 G A 2: 91,473,949 G158S probably damaging Het
Mast1 G A 8: 84,935,723 P52L probably damaging Het
Med13l A G 5: 118,761,323 D2148G probably null Het
Med24 A G 11: 98,706,388 S889P probably benign Het
Mgam T A 6: 40,759,120 M851K probably damaging Het
Mkln1 T A 6: 31,507,667 L710H probably damaging Het
Morf4l1 A T 9: 90,094,448 F276I possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myt1 T A 2: 181,820,070 S574R probably damaging Het
Nol11 C A 11: 107,168,347 V644F probably damaging Het
Nusap1 C A 2: 119,627,691 Q103K possibly damaging Het
Ovgp1 A G 3: 105,986,596 probably benign Het
Pcdh9 C T 14: 93,887,538 V399M probably damaging Het
Plekhh1 T C 12: 79,055,232 S359P probably benign Het
Prg4 G C 1: 150,454,759 probably benign Het
Ptpn14 C T 1: 189,850,546 A530V probably benign Het
Rho A G 6: 115,933,902 Y136C probably damaging Het
Rps3 C T 7: 99,479,896 R173H probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall2 T C 14: 52,314,047 N564D probably damaging Het
Sart3 G A 5: 113,752,427 R452* probably null Het
Sbf2 T C 7: 110,447,091 I300V probably damaging Het
Sgo2b A T 8: 63,928,733 V355E possibly damaging Het
Slc22a5 T C 11: 53,865,825 K553R possibly damaging Het
Syne1 A G 10: 5,405,456 V375A probably damaging Het
Trafd1 T C 5: 121,378,741 E28G probably benign Het
Tsc2 T C 17: 24,599,812 K1292R probably damaging Het
Twnk A G 19: 45,007,451 T108A probably damaging Het
Vps16 T C 2: 130,438,676 S208P possibly damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
feeling UTSW 9 73693271 missense possibly damaging 0.46
Inkling UTSW 9 73931844 missense probably damaging 1.00
notion UTSW 9 73736562 missense probably damaging 1.00
BB001:Unc13c UTSW 9 73734408 missense probably benign 0.05
BB011:Unc13c UTSW 9 73734408 missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7924:Unc13c UTSW 9 73734408 missense probably benign 0.05
R8047:Unc13c UTSW 9 73812354 nonsense probably null
R8167:Unc13c UTSW 9 73736703 missense probably damaging 0.99
R8202:Unc13c UTSW 9 73736562 missense probably damaging 1.00
R8210:Unc13c UTSW 9 73484938 missense probably benign 0.13
R8352:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8368:Unc13c UTSW 9 73930788 missense probably benign 0.15
R8452:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8535:Unc13c UTSW 9 73540371 missense probably benign
R8677:Unc13c UTSW 9 73932961 missense probably benign 0.00
R8700:Unc13c UTSW 9 73572397 missense probably benign 0.44
R8848:Unc13c UTSW 9 73525981 missense probably benign
R8902:Unc13c UTSW 9 73749548 missense probably damaging 0.97
R8953:Unc13c UTSW 9 73932762 missense probably benign 0.00
R8961:Unc13c UTSW 9 73932242 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGGAGAAGTCTTTGTGACCC -3'
(R):5'- AGACCCTTGACCTTCCACAG -3'

Sequencing Primer
(F):5'- GGAGAAGTCTTTGTGACCCTCTTC -3'
(R):5'- AGGAGCGCCATCCACTTTC -3'
Posted On2015-04-17