Incidental Mutation 'R8535:Unc13c'
ID659206
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8535 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73540371 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1849 (T1849I)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably benign
Transcript: ENSMUST00000075245
AA Change: T1849I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: T1849I

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184666
AA Change: T1849I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: T1849I

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A T 11: 54,338,502 I362F probably damaging Het
Anks1b T A 10: 90,948,631 S1154T probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cd163l1 G A 7: 140,224,721 V546M probably benign Het
Chd7 T A 4: 8,859,211 S2434T possibly damaging Het
Crybg2 T C 4: 134,081,203 S1372P probably damaging Het
Dock5 A G 14: 67,793,976 Y1002H probably benign Het
Dst T C 1: 34,186,001 S1163P probably damaging Het
Dusp27 T C 1: 166,101,161 D294G probably benign Het
Fah A T 7: 84,601,097 S14T probably benign Het
Gcnt7 T C 2: 172,454,546 I119M possibly damaging Het
Gja10 G A 4: 32,602,274 L37F probably damaging Het
Gm10750 A G 2: 149,015,968 V121A unknown Het
Klhl25 G A 7: 75,866,095 V250I probably benign Het
Kmt2a A C 9: 44,819,515 S200R possibly damaging Het
Map1b T A 13: 99,435,154 D353V probably damaging Het
Myh8 G A 11: 67,278,915 R20Q probably damaging Het
Olfr1262 G A 2: 90,003,167 V254M probably benign Het
Olfr764-ps1 T C 10: 129,034,023 Y273C probably damaging Het
Pcnt G A 10: 76,420,205 R734W probably damaging Het
Pkn3 A T 2: 30,079,924 probably null Het
Ptpn21 T A 12: 98,680,026 T1058S probably damaging Het
Ryr3 A G 2: 112,949,088 probably null Het
Sardh T A 2: 27,239,645 I263F probably damaging Het
Sh3bp5 A G 14: 31,417,418 V66A probably benign Het
Taf4b T A 18: 14,822,138 S583T probably damaging Het
Tbcb G A 7: 30,226,996 P132L probably benign Het
Tcirg1 A G 19: 3,896,324 I791T probably damaging Het
Tmeff2 T A 1: 51,181,826 V320D probably damaging Het
Tnfrsf19 T C 14: 60,970,968 E368G probably benign Het
Trdv2-1 T A 14: 53,946,515 I67N probably damaging Het
Vav2 G A 2: 27,271,829 T655I probably damaging Het
Vps50 T C 6: 3,565,612 Y517H possibly damaging Het
Wdr27 G A 17: 14,903,537 T558I possibly damaging Het
Yeats2 C T 16: 20,159,176 R137W probably damaging Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
feeling UTSW 9 73693271 missense possibly damaging 0.46
Inkling UTSW 9 73931844 missense probably damaging 1.00
notion UTSW 9 73736562 missense probably damaging 1.00
BB001:Unc13c UTSW 9 73734408 missense probably benign 0.05
BB011:Unc13c UTSW 9 73734408 missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7924:Unc13c UTSW 9 73734408 missense probably benign 0.05
R8047:Unc13c UTSW 9 73812354 nonsense probably null
R8167:Unc13c UTSW 9 73736703 missense probably damaging 0.99
R8202:Unc13c UTSW 9 73736562 missense probably damaging 1.00
R8210:Unc13c UTSW 9 73484938 missense probably benign 0.13
R8352:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8368:Unc13c UTSW 9 73930788 missense probably benign 0.15
R8452:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8677:Unc13c UTSW 9 73932961 missense probably benign 0.00
R8700:Unc13c UTSW 9 73572397 missense probably benign 0.44
R8848:Unc13c UTSW 9 73525981 missense probably benign
R8902:Unc13c UTSW 9 73749548 missense probably damaging 0.97
R8953:Unc13c UTSW 9 73932762 missense probably benign 0.00
R8961:Unc13c UTSW 9 73932242 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCACCACCAGGAATTCTG -3'
(R):5'- TAGTGGTTGCAGTGACCCAC -3'

Sequencing Primer
(F):5'- TTCTGGGCAATAAGGAAAGGTTAAG -3'
(R):5'- ACCTGAAGAGCGTCCATGTTG -3'
Posted On2021-01-18