Incidental Mutation 'R4077:Unc13c'
ID316628
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission 041622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4077 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 73736539 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1214 (W1214*)
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably null
Transcript: ENSMUST00000075245
AA Change: W1214*
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: W1214*

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184666
AA Change: W1214*
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: W1214*

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 T A 2: 150,848,459 probably null Het
Adam33 T C 2: 131,063,524 probably benign Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Atrn T C 2: 130,964,930 probably null Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cdnf A G 2: 3,521,023 Y84C probably damaging Het
Chdh T C 14: 30,035,340 S407P probably damaging Het
Cmtr1 C A 17: 29,685,975 T300K probably damaging Het
Dennd2d A T 3: 106,482,623 probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
Erbb4 T C 1: 68,040,337 T1195A probably benign Het
Ermard T A 17: 15,053,376 S408T probably benign Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
F13b T A 1: 139,501,770 F9I unknown Het
Fnbp4 C T 2: 90,758,477 R531* probably null Het
Gdf6 A G 4: 9,844,776 Y100C probably damaging Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm2016 A T 12: 87,876,940 D119V possibly damaging Het
Gm9774 A C 3: 92,428,888 probably benign Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Grm8 T C 6: 27,760,209 H374R probably benign Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs A G 11: 120,477,376 K277E probably damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hoxa11 A T 6: 52,245,524 Y66N probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igdcc4 T A 9: 65,131,765 L944Q probably damaging Het
Ighv3-1 C A 12: 113,964,487 S84I probably damaging Het
Iqgap2 T C 13: 95,657,867 D1199G probably damaging Het
Kcnk10 A T 12: 98,434,946 M490K probably benign Het
Kirrel A G 3: 87,085,080 probably null Het
Lias A T 5: 65,395,425 T124S probably benign Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Lrrc37a T A 11: 103,497,982 T2206S unknown Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mis12 A G 11: 71,025,308 T56A probably benign Het
Olfr1118 T A 2: 87,308,864 M25K probably null Het
Olfr1287 A G 2: 111,449,503 D121G probably damaging Het
Olfr1451 T C 19: 12,999,871 V295A probably damaging Het
Olfr365 T A 2: 37,202,012 I257N possibly damaging Het
Otof A T 5: 30,419,506 L134Q possibly damaging Het
Pds5b T A 5: 150,794,359 V1155E possibly damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phyhipl C T 10: 70,569,073 V57I probably damaging Het
Plekha5 T A 6: 140,555,921 probably null Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Proser1 A G 3: 53,478,541 T615A probably damaging Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rassf2 G A 2: 132,012,602 P7S probably benign Het
Sart1 A T 19: 5,382,743 L521Q possibly damaging Het
Scgb1b21 T A 7: 33,527,693 noncoding transcript Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Secisbp2l A G 2: 125,751,865 probably benign Het
Svil A G 18: 5,063,522 E931G probably benign Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tdrd1 A G 19: 56,831,073 M2V probably benign Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tram1 A G 1: 13,566,375 V358A probably benign Het
Vps13b T C 15: 35,455,128 C728R probably damaging Het
Wwox A G 8: 114,439,741 probably benign Het
Zbtb41 G A 1: 139,429,326 V440I probably benign Het
Zfp777 T C 6: 48,025,522 S589G probably benign Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCATTATTCAGTAGCAAGC -3'
(R):5'- GGAGGACAAGACCCAGACTATC -3'

Sequencing Primer
(F):5'- GCCATTATTCAGTAGCAAGCAACTTG -3'
(R):5'- GACTATCATCACAGCCATGAAAG -3'
Posted On2015-05-15