Incidental Mutation 'R4038:Eef2kmt'
ID313811
Institutional Source Beutler Lab
Gene Symbol Eef2kmt
Ensembl Gene ENSMUSG00000022544
Gene Nameeukaryotic elongation factor 2 lysine methyltransferase
Synonyms5730409G15Rik, Fam86
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5244152-5255983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5245271 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 335 (V335D)
Ref Sequence ENSEMBL: ENSMUSP00000068003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049207] [ENSMUST00000064635] [ENSMUST00000100196] [ENSMUST00000139584]
Predicted Effect probably benign
Transcript: ENSMUST00000049207
SMART Domains Protein: ENSMUSP00000046534
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 246 422 8e-14 PFAM
Pfam:Glyco_trans_1_4 250 400 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064635
AA Change: V335D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068003
Gene: ENSMUSG00000022544
AA Change: V335D

DomainStartEndE-ValueType
Pfam:FAM86 6 99 2.7e-42 PFAM
Pfam:Methyltransf_16 119 299 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100196
SMART Domains Protein: ENSMUSP00000097770
Gene: ENSMUSG00000039427

DomainStartEndE-ValueType
transmembrane domain 5 23 N/A INTRINSIC
Pfam:Glycos_transf_1 270 447 2.4e-13 PFAM
Pfam:Glyco_trans_1_4 276 426 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132225
Predicted Effect probably benign
Transcript: ENSMUST00000139584
SMART Domains Protein: ENSMUSP00000123572
Gene: ENSMUSG00000022544

DomainStartEndE-ValueType
Pfam:FAM86 1 100 2.7e-62 PFAM
Pfam:Methyltransf_16 119 299 2e-23 PFAM
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230238
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Eef2kmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2259:Eef2kmt UTSW 16 5245308 missense probably benign 0.30
R2267:Eef2kmt UTSW 16 5255940 start gained probably benign
R4036:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4037:Eef2kmt UTSW 16 5245271 missense probably damaging 0.98
R4088:Eef2kmt UTSW 16 5253035 missense probably damaging 1.00
R4836:Eef2kmt UTSW 16 5249003 missense probably damaging 0.98
R4974:Eef2kmt UTSW 16 5249012 missense probably benign 0.14
R5023:Eef2kmt UTSW 16 5247599 missense probably damaging 1.00
R5282:Eef2kmt UTSW 16 5245358 missense probably benign 0.27
R5444:Eef2kmt UTSW 16 5249095 intron probably benign
R5635:Eef2kmt UTSW 16 5249029 missense probably damaging 0.99
R6616:Eef2kmt UTSW 16 5247482 missense probably damaging 0.98
R7320:Eef2kmt UTSW 16 5250509 missense possibly damaging 0.93
R7343:Eef2kmt UTSW 16 5247435 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAACAGAAGCCTTTCCGC -3'
(R):5'- TGTGGCCAAGCAAATCAGC -3'

Sequencing Primer
(F):5'- GCTTTCCGCTTTCCCATGACAG -3'
(R):5'- GCAAATCAGCTTGAACACACAG -3'
Posted On2015-04-30