Incidental Mutation 'R4776:Gnb1l'
ID367969
Institutional Source Beutler Lab
Gene Symbol Gnb1l
Ensembl Gene ENSMUSG00000000884
Gene Nameguanine nucleotide binding protein (G protein), beta polypeptide 1-like
SynonymsESTM55, Wdvcf, Wdr14, Me49f07
MMRRC Submission 042413-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4776 (G1)
Quality Score161
Status Validated
Chromosome16
Chromosomal Location18498713-18566679 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 18548096 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 140 (Q140*)
Ref Sequence ENSEMBL: ENSMUSP00000156162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000904] [ENSMUST00000090086] [ENSMUST00000115600] [ENSMUST00000115601] [ENSMUST00000139625] [ENSMUST00000147739] [ENSMUST00000149035] [ENSMUST00000167778] [ENSMUST00000231621]
Predicted Effect silent
Transcript: ENSMUST00000000904
SMART Domains Protein: ENSMUSP00000000904
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 112 143 1e-9 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000090086
AA Change: Q140*
SMART Domains Protein: ENSMUSP00000087544
Gene: ENSMUSG00000000884
AA Change: Q140*

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115600
AA Change: Q140*
SMART Domains Protein: ENSMUSP00000111263
Gene: ENSMUSG00000000884
AA Change: Q140*

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 136 188 3e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000115601
AA Change: Q140*
SMART Domains Protein: ENSMUSP00000111264
Gene: ENSMUSG00000000884
AA Change: Q140*

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 138 179 1e-16 BLAST
WD40 182 221 4.79e-1 SMART
WD40 224 266 4.79e-1 SMART
WD40 269 307 6.04e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129952
Predicted Effect probably null
Transcript: ENSMUST00000139625
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000120897
Gene: ENSMUSG00000000884
AA Change: Q37*

DomainStartEndE-ValueType
Blast:WD40 35 75 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147739
SMART Domains Protein: ENSMUSP00000123200
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000149035
AA Change: Q37*
SMART Domains Protein: ENSMUSP00000114875
Gene: ENSMUSG00000000884
AA Change: Q37*

DomainStartEndE-ValueType
Blast:WD40 35 76 8e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151253
Predicted Effect probably null
Transcript: ENSMUST00000167778
AA Change: Q171*
SMART Domains Protein: ENSMUSP00000130371
Gene: ENSMUSG00000000884
AA Change: Q171*

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232235
Predicted Effect probably null
Transcript: ENSMUST00000231621
AA Change: Q140*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit significantly reduced prepulse inhibition. Homozygotes die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Med12l T C 3: 59,233,212 I868T probably damaging Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Gnb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Gnb1l APN 16 18544200 missense probably damaging 1.00
IGL02860:Gnb1l APN 16 18552535 missense probably damaging 0.99
IGL03155:Gnb1l APN 16 18540532 splice site probably null
IGL03169:Gnb1l APN 16 18540455 missense probably damaging 1.00
R0017:Gnb1l UTSW 16 18541060 missense probably damaging 1.00
R0267:Gnb1l UTSW 16 18548089 splice site probably benign
R0365:Gnb1l UTSW 16 18552461 missense possibly damaging 0.95
R0845:Gnb1l UTSW 16 18552473 missense probably benign 0.01
R2975:Gnb1l UTSW 16 18564266 missense probably damaging 1.00
R3438:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R3439:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R4650:Gnb1l UTSW 16 18544275 critical splice donor site probably null
R7135:Gnb1l UTSW 16 18545168 missense probably benign 0.05
R7290:Gnb1l UTSW 16 18564056 missense probably benign 0.37
R7488:Gnb1l UTSW 16 18540470 missense possibly damaging 0.90
R8195:Gnb1l UTSW 16 18544215 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TTGTTTTGTAAGGACCCCAGCAG -3'
(R):5'- TGGTCTCTAAGGGACAGTGC -3'

Sequencing Primer
(F):5'- CAGCAGCATCTAAGCTCTCTAG -3'
(R):5'- TCTCTAAGGGACAGTGCCCATAG -3'
Posted On2015-12-29