Incidental Mutation 'R4802:Shroom3'
ID 370290
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms D5Ertd287e, Shrm3, Shrm
MMRRC Submission 042424-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4802 (G1)
Quality Score 197
Status Validated
Chromosome 5
Chromosomal Location 92683435-92965318 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92943086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (93/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 167 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
4932416K20Rik T A 8: 104,797,032 noncoding transcript Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abca13 G T 11: 9,522,341 G4249V possibly damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Cbr4 T C 8: 61,490,079 probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y918* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Eif2ak3 T C 6: 70,887,893 Y578H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Entpd2 T G 2: 25,399,764 probably null Het
Ephb4 T C 5: 137,365,506 L582P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L562Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10619 T A 7: 73,810,025 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W80* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm28042 T C 2: 120,042,054 probably benign Het
Gm4953 A T 1: 159,168,418 noncoding transcript Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Itpr2 T C 6: 146,371,331 T855A probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R505* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Myof T C 19: 37,945,738 T908A probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Neb T C 2: 52,200,703 T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt19 T C 7: 35,556,139 probably benign Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprf G A 4: 118,210,329 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Scel A C 14: 103,583,100 T348P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tarbp1 C G 8: 126,474,889 E59D possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Ttn T A 2: 76,964,646 probably benign Het
Uba1y T G Y: 825,890 probably null Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
R8934:Shroom3 UTSW 5 92941725 missense probably damaging 1.00
R8938:Shroom3 UTSW 5 92943071 missense probably damaging 1.00
R9083:Shroom3 UTSW 5 92950674 missense probably damaging 0.97
R9108:Shroom3 UTSW 5 92940116 missense probably damaging 1.00
R9124:Shroom3 UTSW 5 92964542 missense probably benign 0.19
R9295:Shroom3 UTSW 5 92950619 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- CTTAACTGTCAGAACGGTAACCAAC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On 2016-02-04