Mutagenetix > Incidental Mutation

Incidental Mutation 'R6893:Shroom3'

538154

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6893 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92942204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 938 (T938A)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: T763A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: T763A

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: T763A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: T763A

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: T938A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: T938A

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168878

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: T857A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.7%
20x: 95.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	T	A	8: 24,878,754	D538V	probably damaging	Het
Akap9	T	C	5: 3,961,709	I804T	probably benign	Het
Amy1	T	C	3: 113,563,632	E186G	probably benign	Het
Best1	A	G	19: 9,997,082	Y33H	probably damaging	Het
Cacna1s	C	A	1: 136,077,693	N405K	probably benign	Het
Casp7	T	C	19: 56,433,309	Y60H	probably damaging	Het
Ccdc61	T	C	7: 18,892,563	N367S	possibly damaging	Het
Cnksr3	A	T	10: 7,135,129		probably null	Het
Col14a1	A	C	15: 55,444,648		probably benign	Het
Cyp3a57	A	T	5: 145,386,974	K424*	probably null	Het
Dpep3	T	C	8: 105,973,842	K411E	probably benign	Het
Ebf2	T	A	14: 67,237,559	V81E	probably benign	Het
Ehbp1	G	T	11: 22,014,945	T1084K	probably damaging	Het
Fastkd2	C	T	1: 63,731,794	A103V	possibly damaging	Het
Gm13762	A	G	2: 88,973,799	F31L	probably benign	Het
Gtf3c2	T	C	5: 31,166,378	K525E	probably benign	Het
Hdac2	A	G	10: 36,997,007	E287G	probably damaging	Het
Ifi207	T	A	1: 173,727,642	T832S	possibly damaging	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Lef1	A	G	3: 131,115,500	D55G	possibly damaging	Het
Lipo2	G	T	19: 33,721,007	Y323*	probably null	Het
Mettl24	C	T	10: 40,737,798	R178C	probably damaging	Het
Nat6	A	G	9: 107,583,026	E40G	probably damaging	Het
Ndrg4	C	A	8: 95,706,601	C66*	probably null	Het
Nemf	A	G	12: 69,352,336	V140A	probably benign	Het
Nid2	T	A	14: 19,789,787	F815I	probably benign	Het
Olfr1076	A	G	2: 86,508,792	E111G	probably damaging	Het
Olfr1459	A	C	19: 13,145,742	S306A	probably benign	Het
Olfr876	A	C	9: 37,804,845	*311C	probably null	Het
Olfr918	A	T	9: 38,673,059	N141K	possibly damaging	Het
Pcdhga3	T	C	18: 37,676,545	S684P	probably benign	Het
Plch1	A	T	3: 63,753,141	C352*	probably null	Het
Plscr2	G	A	9: 92,290,704	V139I	probably benign	Het
Ppa1	T	A	10: 61,672,403	C270S	probably benign	Het
Ryr2	T	A	13: 11,829,654	M399L	possibly damaging	Het
Scn3a	A	G	2: 65,525,754	V212A	possibly damaging	Het
Serpina3b	A	G	12: 104,133,026	K267E	probably benign	Het
Specc1	A	C	11: 62,132,453	S115R	probably benign	Het
Stim2	C	T	5: 54,053,445	T74I	probably benign	Het
Sult6b2	T	A	6: 142,804,299	D31V	possibly damaging	Het
Tbc1d24	A	T	17: 24,182,518	W406R	probably damaging	Het
Tmprss11b	A	G	5: 86,663,386		probably null	Het
Trappc9	A	G	15: 72,925,650	Y575H	possibly damaging	Het
Trim63	C	T	4: 134,323,101	T232M	probably damaging	Het
Ttn	A	T	2: 76,767,836	S19578T	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr63	T	C	3: 146,080,429	E366G	probably damaging	Het
Xpo4	T	A	14: 57,582,310	E1139D	probably benign	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGTGCAGCCATTTGATCCG -3'
(R):5'- TAGGAGCGCTTCTTCTGCTC -3'

Sequencing Primer
(F):5'- TGGACCTCCTGCCCGAG -3'
(R):5'- CTGCTCGACAGTGAGGC -3'

Posted On

2018-11-06