Incidental Mutation 'R4914:Emc1'
ID 379792
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 042516-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R4914 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 139102476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 924 (R924*)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably null
Transcript: ENSMUST00000042096
AA Change: R921*
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R921*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082262
AA Change: R924*
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R924*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably null
Transcript: ENSMUST00000179784
AA Change: R924*
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R924*

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace G A 11: 105,870,423 (GRCm39) V281M probably damaging Het
Ap1b1 C T 11: 4,974,400 (GRCm39) T363I possibly damaging Het
Apobec2 T C 17: 48,730,153 (GRCm39) E171G probably benign Het
Arhgef1 T A 7: 24,623,264 (GRCm39) L436Q probably damaging Het
Atxn2 T A 5: 121,887,159 (GRCm39) D276E probably damaging Het
AU040320 A T 4: 126,729,469 (GRCm39) K544* probably null Het
Baz2b T A 2: 59,744,387 (GRCm39) T1373S possibly damaging Het
Bcas1 T C 2: 170,220,806 (GRCm39) D324G probably damaging Het
Bdp1 A G 13: 100,192,844 (GRCm39) V1330A probably benign Het
Bfsp1 C T 2: 143,669,391 (GRCm39) R396Q probably benign Het
Bpifb9b T A 2: 154,156,026 (GRCm39) probably null Het
Cabs1 T C 5: 88,128,296 (GRCm39) Y316H probably damaging Het
Carmil2 A G 8: 106,420,175 (GRCm39) K908E possibly damaging Het
Ccdc188 C A 16: 18,036,083 (GRCm39) P86Q probably benign Het
Cdh26 T C 2: 178,091,614 (GRCm39) S58P probably benign Het
Cemip2 G A 19: 21,786,653 (GRCm39) V472I probably benign Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dclk2 A T 3: 86,732,049 (GRCm39) probably null Het
Dennd5a A G 7: 109,500,296 (GRCm39) F943S probably damaging Het
Disp2 A T 2: 118,620,935 (GRCm39) S556C probably damaging Het
Dnai3 A G 3: 145,772,582 (GRCm39) I488T probably damaging Het
Dpp4 A T 2: 62,178,236 (GRCm39) M632K probably benign Het
E030030I06Rik G A 10: 21,990,197 (GRCm39) T192M possibly damaging Het
Ece2 C T 16: 20,462,820 (GRCm39) R582C probably damaging Het
Ehbp1 T C 11: 22,096,592 (GRCm39) D299G probably benign Het
Etaa1 A T 11: 17,896,532 (GRCm39) S528R probably benign Het
Exoc2 A T 13: 31,060,796 (GRCm39) N569K probably benign Het
Fasn T G 11: 120,707,472 (GRCm39) N799T probably benign Het
Fbxo3 T G 2: 103,885,311 (GRCm39) N388K probably damaging Het
Fbxw16 C T 9: 109,267,245 (GRCm39) V329I probably benign Het
Fer1l4 T C 2: 155,873,220 (GRCm39) K1287E probably benign Het
Fermt1 A G 2: 132,748,760 (GRCm39) V621A probably damaging Het
Fnbp4 A G 2: 90,581,513 (GRCm39) T189A probably benign Het
Fut8 G T 12: 77,521,818 (GRCm39) A486S probably damaging Het
G6pd2 T A 5: 61,967,672 (GRCm39) Y482* probably null Het
Gfra1 A T 19: 58,255,522 (GRCm39) S308R probably damaging Het
Glp2r G T 11: 67,648,419 (GRCm39) Y94* probably null Het
Gper1 A G 5: 139,412,623 (GRCm39) I323V probably benign Het
Grm5 C A 7: 87,779,337 (GRCm39) R958S probably benign Het
H2-DMb2 A G 17: 34,369,503 (GRCm39) T85A probably benign Het
Hgsnat A G 8: 26,454,866 (GRCm39) S220P probably damaging Het
Hspa12a A T 19: 58,787,884 (GRCm39) M646K probably damaging Het
Inpp5f A T 7: 128,286,840 (GRCm39) D573V probably damaging Het
Jmjd1c A G 10: 67,054,750 (GRCm39) N344D probably damaging Het
Kif1c A G 11: 70,599,681 (GRCm39) E471G probably damaging Het
Lalba T A 15: 98,380,061 (GRCm39) N63I probably benign Het
Mcoln1 T A 8: 3,557,483 (GRCm39) L163* probably null Het
Mllt1 T C 17: 57,206,813 (GRCm39) T344A probably benign Het
Mpzl2 T A 9: 44,955,146 (GRCm39) D114E probably benign Het
Myef2 T A 2: 124,951,659 (GRCm39) K259* probably null Het
Myh8 C A 11: 67,183,510 (GRCm39) D740E probably damaging Het
Myo1b A T 1: 51,863,367 (GRCm39) probably null Het
Nfix T C 8: 85,498,458 (GRCm39) I172V probably benign Het
Or1b1 A T 2: 36,995,170 (GRCm39) I164N possibly damaging Het
Or2h2 T C 17: 37,396,883 (GRCm39) Y58C probably damaging Het
Or2w1b A T 13: 21,300,567 (GRCm39) Q235L probably benign Het
Or3a1b A T 11: 74,012,705 (GRCm39) I197F probably benign Het
Or5b106 T A 19: 13,123,355 (GRCm39) I223L possibly damaging Het
Orc1 T C 4: 108,461,755 (GRCm39) F584S probably damaging Het
Osgin1 C A 8: 120,169,283 (GRCm39) A60D possibly damaging Het
Pde4dip C A 3: 97,622,644 (GRCm39) V1522L probably benign Het
Phactr1 A G 13: 43,287,439 (GRCm39) T556A possibly damaging Het
Ppfia2 G C 10: 106,597,978 (GRCm39) L180F probably damaging Het
Ppm1k T A 6: 57,487,762 (GRCm39) N354Y probably damaging Het
Ppp1r1a A G 15: 103,446,265 (GRCm39) V14A probably damaging Het
Prkcd A T 14: 30,327,395 (GRCm39) probably null Het
Ranbp17 T C 11: 33,163,425 (GRCm39) S1082G probably benign Het
Rere T A 4: 150,703,601 (GRCm39) W1528R probably damaging Het
Rnf103 T A 6: 71,487,248 (GRCm39) F626L possibly damaging Het
Rsrc2 A G 5: 123,877,613 (GRCm39) probably benign Het
Scin T A 12: 40,119,373 (GRCm39) I552F possibly damaging Het
Scn3a T C 2: 65,291,799 (GRCm39) N1649S probably damaging Het
Slain2 T A 5: 73,115,609 (GRCm39) M448K probably benign Het
Slc25a54 T C 3: 109,018,395 (GRCm39) F292L probably benign Het
Slc4a1 A G 11: 102,243,279 (GRCm39) V784A probably damaging Het
Slco1b2 G A 6: 141,615,096 (GRCm39) V334I probably benign Het
Slf2 T G 19: 44,960,100 (GRCm39) D1022E probably damaging Het
Smg8 T C 11: 86,971,536 (GRCm39) E745G probably damaging Het
Smyd1 T G 6: 71,196,321 (GRCm39) I322L probably benign Het
Snx13 G A 12: 35,182,032 (GRCm39) V694I possibly damaging Het
Sox6 T C 7: 115,076,199 (GRCm39) D814G probably damaging Het
Spag6 A T 2: 18,750,360 (GRCm39) I469F probably benign Het
Spsb2 A C 6: 124,786,711 (GRCm39) E148A probably benign Het
Srprb C A 9: 103,079,147 (GRCm39) V747L possibly damaging Het
Stam A G 2: 14,107,227 (GRCm39) E16G probably damaging Het
Taar5 A T 10: 23,847,468 (GRCm39) I289F possibly damaging Het
Tgif1 C T 17: 71,152,242 (GRCm39) R70H probably damaging Het
Top2a A T 11: 98,893,786 (GRCm39) L1036H probably damaging Het
Tph1 T A 7: 46,303,283 (GRCm39) I232F probably damaging Het
Ttn T C 2: 76,577,175 (GRCm39) T24573A probably damaging Het
Tub C T 7: 108,620,161 (GRCm39) R102* probably null Het
Ube2n T A 10: 95,377,607 (GRCm39) W129R possibly damaging Het
Usp8 A T 2: 126,562,060 (GRCm39) K85* probably null Het
Vmn2r81 A T 10: 79,106,357 (GRCm39) K445M probably null Het
Vps45 T C 3: 95,926,943 (GRCm39) T535A probably damaging Het
Zfp1007 A G 5: 109,826,396 (GRCm39) S59P probably damaging Het
Zfp157 T C 5: 138,454,557 (GRCm39) S252P possibly damaging Het
Zfp605 T A 5: 110,275,567 (GRCm39) C228* probably null Het
Zfp791 T A 8: 85,837,580 (GRCm39) I95L probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGCCTCAGAGGAAATTCAGG -3'
(R):5'- CTTGGACGGGTAAACTCGAG -3'

Sequencing Primer
(F):5'- CCTCAGAGGAAATTCAGGTTTAGTG -3'
(R):5'- CTCGAGTTTGGTAAATATCCAAACCG -3'
Posted On 2016-04-15