Mutagenetix > Incidental Mutation

Incidental Mutation 'R5096:Kcnb2'

388010

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

042685-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5096 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15710844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 647 (R647G)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably benign
Transcript: ENSMUST00000170146
AA Change: R647G

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000175681
AA Change: R647G

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: R647G

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Meta Mutation Damage Score

0.1810

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	A	T	14: 54,679,222		probably benign	Het
Adar	T	A	3: 89,747,291	*728C	probably null	Het
Ap3b1	A	G	13: 94,479,849	R753G	unknown	Het
Atp9b	C	T	18: 80,762,184	V720I	probably benign	Het
AY358078	A	C	14: 51,826,118	D407A	probably benign	Het
Ccdc185	A	G	1: 182,748,789	S112P	possibly damaging	Het
Cir1	A	G	2: 73,303,761	S155P	probably damaging	Het
Colq	C	T	14: 31,552,954	E76K	possibly damaging	Het
Cthrc1	T	A	15: 39,084,420	I104N	probably damaging	Het
D930020B18Rik	A	T	10: 121,667,804	I92L	probably benign	Het
Eif3i	C	T	4: 129,600,444	E21K	probably damaging	Het
Fam114a1	T	A	5: 64,979,891	M59K	probably benign	Het
Fam163b	A	G	2: 27,112,749	S79P	probably benign	Het
Fam181b	T	G	7: 93,081,245		probably benign	Het
Fsip2	G	A	2: 82,991,116	S5731N	probably benign	Het
Fzd9	C	T	5: 135,249,859	V391I	probably damaging	Het
Gbp5	A	G	3: 142,501,361	D97G	probably damaging	Het
Gm10715	T	C	9: 3,038,157		probably benign	Het
Grhl1	A	T	12: 24,603,050	K418M	probably damaging	Het
H2-Q4	T	A	17: 35,379,713		probably benign	Het
Hmcn1	C	A	1: 150,610,669	A4329S	probably damaging	Het
Hspa8	T	C	9: 40,802,901		probably benign	Het
Ica1l	T	C	1: 60,028,154	T26A	possibly damaging	Het
Ifi209	T	A	1: 173,644,734	N380K	probably benign	Het
Inpp5e	G	T	2: 26,399,525	N482K	probably damaging	Het
Iqsec3	C	T	6: 121,386,698	V866M	probably damaging	Het
Kbtbd2	A	G	6: 56,779,275	V492A	probably benign	Het
Lcmt1	T	G	7: 123,401,468	V75G	probably damaging	Het
Lrp4	A	G	2: 91,485,792	I752V	possibly damaging	Het
Mmp17	C	A	5: 129,605,563	P422Q	probably damaging	Het
Myo3a	A	T	2: 22,574,242	H165L	probably benign	Het
Nos3	C	T	5: 24,371,957	T494I	probably damaging	Het
Olfr1184	C	T	2: 88,487,302	T190I	possibly damaging	Het
Olfr356	T	C	2: 36,937,803	V228A	possibly damaging	Het
Olfr52	A	G	2: 86,181,932	Y60H	probably damaging	Het
Olfr638	T	C	7: 104,003,460	Y68H	probably benign	Het
Pkn2	A	C	3: 142,839,331	V27G	probably damaging	Het
Scube2	T	C	7: 109,799,244		probably benign	Het
Skint7	A	G	4: 111,981,955	I149V	probably damaging	Het
Smc4	T	A	3: 69,021,279	I412K	probably damaging	Het
Snx19	T	A	9: 30,428,786	C407S	probably benign	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Sytl2	T	A	7: 90,376,082	I426N	possibly damaging	Het
Tbce	A	T	13: 14,029,405		probably benign	Het
Tdpoz2	T	C	3: 93,652,512	E51G	possibly damaging	Het
Tmem221	A	G	8: 71,558,709	L34P	probably damaging	Het
Tmem92	T	C	11: 94,779,036	T90A	probably benign	Het
Tpr	A	G	1: 150,446,202	D42G	probably damaging	Het
Wt1	A	G	2: 105,143,125	T237A	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGAGGCCATGTGTGTATGAG -3'
(R):5'- CCCTTTCAGCGAGCTCTTAG -3'

Sequencing Primer
(F):5'- AGAGGTGATCTGCCCACAG -3'
(R):5'- TCAGCGAGCTCTTAGGGCTG -3'

Posted On

2016-06-06