Incidental Mutation 'R6981:Kcnb2'
ID 542644
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms 9630047L19Rik, Kv2.2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6981 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 15287254-15723750 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15710256 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 451 (S451P)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably damaging
Transcript: ENSMUST00000170146
AA Change: S451P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000175681
AA Change: S451P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: S451P

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik G A 11: 58,293,718 probably benign Het
5031439G07Rik A C 15: 84,949,597 Y419* probably null Het
Abca2 T A 2: 25,444,139 F1809L probably damaging Het
Ache C T 5: 137,291,678 T423I probably benign Het
Acvrl1 A G 15: 101,138,345 T395A probably damaging Het
Ap3b2 A G 7: 81,477,993 I145T probably damaging Het
Arhgef4 A C 1: 34,722,452 Q263P unknown Het
Asgr2 C T 11: 70,096,810 L45F probably damaging Het
Baiap2l1 T A 5: 144,285,579 Y122F possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Car8 A T 4: 8,185,650 probably null Het
Carns1 T C 19: 4,170,082 T385A probably benign Het
Ccdc47 T C 11: 106,202,737 T41A probably benign Het
Ccne1 A T 7: 38,098,573 probably benign Het
Cdh4 C T 2: 179,797,504 T148I probably benign Het
Cep85 C T 4: 134,152,261 R392Q probably damaging Het
Ces1h T C 8: 93,353,495 T464A unknown Het
Cfl1 T A 19: 5,492,616 S41R possibly damaging Het
Crnn T C 3: 93,148,135 V76A probably damaging Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Dgkh A T 14: 78,627,742 C53* probably null Het
Dhx34 G T 7: 16,215,330 A391E possibly damaging Het
Dlx1 C A 2: 71,532,353 N201K probably benign Het
Dnah6 T C 6: 73,021,178 E4087G probably benign Het
Dock6 T C 9: 21,845,550 Y134C probably damaging Het
Duox2 A G 2: 122,291,227 V662A possibly damaging Het
Dusp12 A G 1: 170,880,961 F12L probably damaging Het
Eppk1 T C 15: 76,111,037 E548G probably benign Het
Foxj2 A G 6: 122,828,444 I92V probably damaging Het
Foxj2 A G 6: 122,842,839 D562G probably benign Het
Gm17728 A G 17: 9,422,159 R34G probably damaging Het
Gpc6 T C 14: 117,624,548 I292T probably damaging Het
Gpr15 T A 16: 58,718,185 K180N probably benign Het
Gtf2ird1 G T 5: 134,383,922 probably benign Het
Hist1h2ah A G 13: 22,035,549 S2P probably benign Het
Hps3 T A 3: 20,022,820 T393S probably damaging Het
Hspa1a A T 17: 34,970,291 probably null Het
Hydin A G 8: 110,531,072 E2378G possibly damaging Het
Ighv1-18 A G 12: 114,682,678 L102P probably damaging Het
Itga5 T A 15: 103,350,226 N814I probably benign Het
Klhl32 T G 4: 24,709,030 I112L probably damaging Het
Knstrn T G 2: 118,834,094 I47R possibly damaging Het
Med23 T A 10: 24,895,824 S581T possibly damaging Het
Mgat5 C T 1: 127,390,851 T361I probably damaging Het
Nipal3 A G 4: 135,479,547 V112A probably damaging Het
Olfr1287 T C 2: 111,449,352 F71L probably benign Het
Olfr1359 A G 13: 21,703,073 E24G probably benign Het
Olfr713 T A 7: 107,036,749 V198D possibly damaging Het
Olfr996 A G 2: 85,579,481 M81V probably benign Het
Paxip1 G A 5: 27,765,768 Q528* probably null Het
Proser2 T C 2: 6,113,990 D14G probably damaging Het
Rp1 T G 1: 4,345,655 I1745L probably benign Het
Rxfp2 G T 5: 150,048,848 probably null Het
Slc45a1 T C 4: 150,638,594 S278G possibly damaging Het
Smurf1 A G 5: 144,886,369 I455T possibly damaging Het
Speg T C 1: 75,430,913 L3188P probably damaging Het
Tcaf3 G T 6: 42,597,125 A51D probably damaging Het
Tecrl T C 5: 83,354,921 N12S possibly damaging Het
Tmem17 T A 11: 22,518,508 I149N possibly damaging Het
Tmem171 A G 13: 98,692,468 V58A possibly damaging Het
Ttn A G 2: 76,861,177 probably benign Het
Ubqln5 A G 7: 104,128,601 S339P probably benign Het
Vmn1r16 T A 6: 57,323,488 I50L probably benign Het
Vmn2r103 A T 17: 19,793,477 Y177F probably benign Het
Zfp28 C A 7: 6,394,693 T709K probably damaging Het
Zfp958 A G 8: 4,626,170 N46S probably benign Het
Zyx T A 6: 42,350,357 V30E unknown Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15711499 missense probably benign
R9321:Kcnb2 UTSW 1 15709569 missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15709513 missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15711220 missense probably benign
R9709:Kcnb2 UTSW 1 15710299 missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGGCTACGGTGACATTTACC -3'
(R):5'- ACCTCCTGGTACTTATTCTCGTAAG -3'

Sequencing Primer
(F):5'- GGCTACGGTGACATTTACCCTAAAAC -3'
(R):5'- AAGATTTGTTGGAGCTCGTTTCTGAC -3'
Posted On 2018-11-28