Mutagenetix > Incidental Mutation

Incidental Mutation 'R6724:Kcnb2'

529730

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6724 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15710440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 512 (Y512C)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably damaging
Transcript: ENSMUST00000170146
AA Change: Y512C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000175681
AA Change: Y512C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y512C

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts5	T	A	16: 85,868,557	T619S	probably benign	Het
Adgra2	G	A	8: 27,114,182	A467T	possibly damaging	Het
AF366264	A	T	8: 13,837,083	L336Q	probably damaging	Het
Alox5	A	T	6: 116,414,548	I416N	probably damaging	Het
Blmh	A	G	11: 76,971,907		probably null	Het
Cftr	T	A	6: 18,255,974	Y567*	probably null	Het
Cnr1	T	A	4: 33,944,728	M372K	possibly damaging	Het
Col6a3	T	C	1: 90,779,152	T2080A	unknown	Het
Crybg3	A	T	16: 59,544,138	C2374S	probably benign	Het
Csmd2	A	G	4: 128,563,371	I3544V	probably damaging	Het
Dnah12	A	T	14: 26,796,223	D1809V	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dnajb12	A	G	10: 59,892,780	D190G	possibly damaging	Het
Dtnb	T	A	12: 3,686,817	V319D	probably damaging	Het
Ercc6	A	T	14: 32,566,331	E820V	probably benign	Het
Fip1l1	T	G	5: 74,591,774	V378G	probably damaging	Het
Gabrg1	T	A	5: 70,754,209	Y358F	possibly damaging	Het
Gcn1l1	T	G	5: 115,609,158		probably null	Het
Gm11011	T	A	2: 169,587,482	T28S	unknown	Het
Gm13762	T	G	2: 88,973,268	I208L	probably benign	Het
Gm14025	A	C	2: 129,038,056	V650G	probably benign	Het
Gm4027	A	T	12: 87,621,984	I129F	unknown	Het
Guf1	C	A	5: 69,566,393	N438K	probably damaging	Het
Hoxa7	T	C	6: 52,215,739	E223G	probably benign	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ipo8	A	T	6: 148,809,975		probably null	Het
Isl2	A	G	9: 55,541,288	D3G	possibly damaging	Het
Kifc1	T	A	17: 33,886,733		probably null	Het
Klhdc10	A	G	6: 30,446,641	D183G	probably damaging	Het
Klra5	T	A	6: 129,906,680	K71N	probably benign	Het
Lrp6	T	C	6: 134,486,541	H559R	possibly damaging	Het
Maml3	T	C	3: 51,855,875	N556S	probably damaging	Het
Man2a1	A	G	17: 64,731,269	I83V	possibly damaging	Het
Mrgpra9	A	G	7: 47,235,038	S293P	probably damaging	Het
Nalcn	A	G	14: 123,298,067	S1282P	probably damaging	Het
Npepps	A	T	11: 97,206,002		probably benign	Het
Olfr1037	A	T	2: 86,085,357	V140E	possibly damaging	Het
Olfr1154	T	G	2: 87,903,602	S25R	probably benign	Het
Olfr1245	A	T	2: 89,574,965	F254I	probably benign	Het
Pkn3	C	A	2: 30,090,550	R818S	possibly damaging	Het
Plekha3	T	A	2: 76,687,401	H190Q	probably damaging	Het
Ppp2r3c	A	T	12: 55,288,496	S261T	probably benign	Het
Ptprj	T	C	2: 90,450,851	D1015G	probably benign	Het
Pus10	T	C	11: 23,729,037	M503T	possibly damaging	Het
Pvr	T	C	7: 19,918,679	R104G	possibly damaging	Het
Rubcnl	A	G	14: 75,052,010	R653G	probably benign	Het
Serpina1a	G	T	12: 103,860,420		probably benign	Het
Shank3	G	A	15: 89,532,453	R265Q	probably damaging	Het
Slc22a22	C	T	15: 57,247,532	R433H	probably damaging	Het
Slc22a26	A	G	19: 7,802,361	I30T	probably benign	Het
Spz1	A	T	13: 92,575,484	N161K	possibly damaging	Het
Tacc2	A	G	7: 130,728,762	R259G	probably damaging	Het
Top1	G	A	2: 160,712,696	V456M	probably damaging	Het
Tpcn2	G	A	7: 145,256,520	A649V	probably benign	Het
Trank1	C	G	9: 111,365,916	R1003G	probably damaging	Het
Tril	T	A	6: 53,819,574	H221L	possibly damaging	Het
Unc79	C	T	12: 103,104,861	T1305I	probably damaging	Het
Unc80	C	T	1: 66,683,191	A2988V	possibly damaging	Het
Vmn1r81	A	T	7: 12,260,672	M3K	probably damaging	Het
Vmn2r78	A	T	7: 86,954,258	D548V	probably damaging	Het
Vwa3b	G	A	1: 37,045,031	R95Q	probably damaging	Het
Wdr6	G	A	9: 108,574,894	H597Y	probably benign	Het
Yme1l1	C	T	2: 23,194,762	T624I	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6371:Kcnb2	UTSW	1	15711212	missense	probably benign
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GGCAGCATCGTTTCTATGAAC -3'
(R):5'- TGTGGGCAGATCACCTCTTC -3'

Sequencing Primer
(F):5'- CGTTTCTATGAACTTAAAGGATGCC -3'
(R):5'- ATCTCCTCCTCATACACACATGG -3'

Posted On

2018-08-01