Mutagenetix > Incidental Mutation

Incidental Mutation 'R6371:Kcnb2'

513503

Institutional Source

Beutler Lab

Gene Symbol

Kcnb2

Ensembl Gene

ENSMUSG00000092083

Gene Name

potassium voltage gated channel, Shab-related subfamily, member 2

Synonyms

9630047L19Rik, Kv2.2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6371 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15287254-15723750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 15711212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 769 (D769E)

Ref Sequence

ENSEMBL: ENSMUSP00000135382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]

AlphaFold

A6H8H5

Predicted Effect

probably benign
Transcript: ENSMUST00000170146
AA Change: D769E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000175681
AA Change: D769E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: D769E

Domain	Start	End	E-Value	Type
BTB	35	144	2.59e-14	SMART
low complexity region	150	166	N/A	INTRINSIC
Pfam:Ion_trans	192	428	1.7e-51	PFAM
Pfam:Ion_trans_2	336	422	2.5e-13	PFAM
Pfam:Kv2channel	471	755	7.7e-149	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	C	T	12: 113,490,274	S237L	probably damaging	Het
Ank3	T	G	10: 69,808,879	L58V	probably damaging	Het
Arsb	A	T	13: 93,790,066	I115F	possibly damaging	Het
Atad2b	T	C	12: 4,973,970	Y32H	probably damaging	Het
Brd1	A	C	15: 88,713,998	M515R	probably benign	Het
Cbx7	A	G	15: 79,918,822	S30P	possibly damaging	Het
Cdk12	A	G	11: 98,245,288	T1123A	unknown	Het
Cep170b	A	G	12: 112,740,945	D375G	probably damaging	Het
Clcn3	T	C	8: 60,937,335	K164E	probably benign	Het
Clip4	A	C	17: 71,856,464	K677T	probably damaging	Het
Clrn2	T	C	5: 45,460,198	I137T	possibly damaging	Het
Cntln	T	C	4: 84,884,579	S39P	probably damaging	Het
Crocc2	T	A	1: 93,215,631	N1318K	probably benign	Het
Emc1	C	T	4: 139,371,665	Q820*	probably null	Het
Fam71e2	A	G	7: 4,759,359	V257A	probably benign	Het
Fbxl2	G	A	9: 113,989,383	T170I	probably damaging	Het
Fyb2	A	G	4: 104,995,778	T552A	probably damaging	Het
Gm2381	G	A	7: 42,820,586	A38V	probably benign	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Hspg2	T	C	4: 137,541,695	Y2213H	probably damaging	Het
Ifnar2	T	C	16: 91,388,098	Y24H	possibly damaging	Het
Inpp5d	T	A	1: 87,699,675	L566Q	probably damaging	Het
Itgb2	C	A	10: 77,548,597	P184H	probably damaging	Het
Lrp1b	A	G	2: 40,851,654	M3087T	possibly damaging	Het
Ltbp3	A	G	19: 5,745,772		probably null	Het
Ms4a6b	A	G	19: 11,520,364	E9G	probably damaging	Het
Nat3	G	A	8: 67,524,179		probably null	Het
Ndufaf1	A	T	2: 119,660,053	D175E	probably damaging	Het
Nop58	T	G	1: 59,711,312		probably benign	Het
Olfr122	A	G	17: 37,772,435	T261A	probably benign	Het
Olfr285	A	G	15: 98,313,338	Y71H	possibly damaging	Het
P3h4	C	T	11: 100,411,749	E354K	probably benign	Het
Plekhm2	T	G	4: 141,629,532	T787P	possibly damaging	Het
Ppia	C	T	11: 6,418,230	T37I	probably benign	Het
Reln	T	A	5: 21,995,513	M1330L	probably benign	Het
Ric1	A	G	19: 29,562,026	E53G	probably benign	Het
Sgip1	T	A	4: 102,966,285	V721E	probably damaging	Het
Slc33a1	A	T	3: 63,943,288	D538E	probably benign	Het
Son	T	C	16: 91,674,741			Het
Srebf1	A	T	11: 60,203,515	S591R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Taok2	G	A	7: 126,870,147	R1170W	probably damaging	Het
Tsc2	A	T	17: 24,626,714	V210E	probably benign	Het
Ttc6	T	A	12: 57,728,463	N1648K	possibly damaging	Het
Vgll3	C	T	16: 65,839,245	P94L	probably damaging	Het
Vmn2r54	A	T	7: 12,615,435	V740E	probably damaging	Het
Yeats2	A	G	16: 20,221,710	E1127G	possibly damaging	Het
Zfp709	T	A	8: 71,889,485	Y252N	probably damaging	Het

Other mutations in Kcnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Kcnb2	APN	1	15711012	missense	probably benign	0.02
IGL01321:Kcnb2	APN	1	15312923	missense	probably benign	0.09
IGL01353:Kcnb2	APN	1	15710824	missense	probably benign	0.02
IGL01990:Kcnb2	APN	1	15312954	missense	probably benign	0.19
IGL02008:Kcnb2	APN	1	15710809	missense	probably benign	0.00
IGL02120:Kcnb2	APN	1	15709861	missense	probably damaging	0.98
IGL02370:Kcnb2	APN	1	15710935	missense	probably benign
IGL02526:Kcnb2	APN	1	15710755	missense	probably damaging	1.00
IGL02859:Kcnb2	APN	1	15710506	missense	probably damaging	1.00
IGL03039:Kcnb2	APN	1	15711211	missense	probably benign
IGL03144:Kcnb2	APN	1	15709888	missense	probably damaging	1.00
F5770:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
PIT4131001:Kcnb2	UTSW	1	15312976	missense	possibly damaging	0.92
R0266:Kcnb2	UTSW	1	15712913	unclassified	probably benign
R0538:Kcnb2	UTSW	1	15712884	unclassified	probably benign
R0611:Kcnb2	UTSW	1	15710440	missense	probably benign	0.07
R1542:Kcnb2	UTSW	1	15710788	missense	probably benign	0.01
R1732:Kcnb2	UTSW	1	15709755	missense	probably benign	0.02
R1995:Kcnb2	UTSW	1	15709766	missense	possibly damaging	0.66
R2166:Kcnb2	UTSW	1	15711316	missense	possibly damaging	0.82
R2444:Kcnb2	UTSW	1	15709567	missense	probably benign
R3025:Kcnb2	UTSW	1	15710835	missense	possibly damaging	0.87
R3886:Kcnb2	UTSW	1	15710415	missense	probably damaging	1.00
R5010:Kcnb2	UTSW	1	15312962	missense	probably benign	0.09
R5039:Kcnb2	UTSW	1	15709500	missense	probably damaging	1.00
R5096:Kcnb2	UTSW	1	15710844	missense	probably benign	0.45
R5444:Kcnb2	UTSW	1	15711492	missense	probably benign
R5926:Kcnb2	UTSW	1	15313011	missense	probably benign	0.01
R6010:Kcnb2	UTSW	1	15710566	missense	possibly damaging	0.85
R6724:Kcnb2	UTSW	1	15710440	missense	probably damaging	1.00
R6981:Kcnb2	UTSW	1	15710256	missense	probably damaging	1.00
R7043:Kcnb2	UTSW	1	15312926	missense	probably benign
R7352:Kcnb2	UTSW	1	15710611	missense	probably benign
R7419:Kcnb2	UTSW	1	15711027	missense	possibly damaging	0.94
R7425:Kcnb2	UTSW	1	15709807	missense	probably damaging	1.00
R7606:Kcnb2	UTSW	1	15312840	missense	probably damaging	1.00
R7978:Kcnb2	UTSW	1	15710613	missense	probably benign	0.15
R7983:Kcnb2	UTSW	1	15312780	missense	probably damaging	0.98
R8115:Kcnb2	UTSW	1	15711627	makesense	probably null
R8156:Kcnb2	UTSW	1	15710056	missense	probably damaging	1.00
R8408:Kcnb2	UTSW	1	15711553	missense	probably damaging	1.00
R8439:Kcnb2	UTSW	1	15312710	missense	probably damaging	1.00
R8726:Kcnb2	UTSW	1	15710652	missense	probably benign	0.00
R8738:Kcnb2	UTSW	1	15710424	missense	probably benign	0.07
R9274:Kcnb2	UTSW	1	15711499	missense	probably benign
R9321:Kcnb2	UTSW	1	15709569	missense	possibly damaging	0.46
R9563:Kcnb2	UTSW	1	15709513	missense	probably damaging	1.00
R9633:Kcnb2	UTSW	1	15711220	missense	probably benign
R9709:Kcnb2	UTSW	1	15710299	missense	probably benign	0.31
V7580:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7581:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7582:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
V7583:Kcnb2	UTSW	1	15710091	missense	probably benign	0.07
Z1088:Kcnb2	UTSW	1	15710091	missense	probably benign	0.03
Z1088:Kcnb2	UTSW	1	15711028	missense	probably benign	0.01
Z1177:Kcnb2	UTSW	1	15710958	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GGAGCAATCCCCTCAAGTCAAG -3'
(R):5'- TCGCCAGGCTTATCTGCTAG -3'

Sequencing Primer
(F):5'- GATCCCTCAAAGTGAACTTTCAG -3'
(R):5'- TGCTAGGCAGTTGGGGC -3'

Posted On

2018-04-27