Incidental Mutation 'R5220:Atg9a'
ID 402252
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 042793-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5220 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 75162372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 505 (V505M)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: V513M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: V513M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably damaging
Transcript: ENSMUST00000187785
AA Change: V72M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: V513M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: V513M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: V513M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: V513M

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189820
AA Change: V505M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,738,045 (GRCm39) E250G probably damaging Het
Adgra1 A G 7: 139,455,512 (GRCm39) N380S probably benign Het
Ap3d1 G A 10: 80,563,001 (GRCm39) P160L probably damaging Het
Chsy3 A T 18: 59,543,102 (GRCm39) I747F probably damaging Het
Clec2g A G 6: 128,958,269 (GRCm39) S100G probably benign Het
Cmya5 G T 13: 93,228,804 (GRCm39) P2095T probably damaging Het
Dcaf10 T C 4: 45,373,909 (GRCm39) W445R possibly damaging Het
Espl1 T A 15: 102,207,012 (GRCm39) L159M probably benign Het
Fbxw8 T C 5: 118,233,776 (GRCm39) D285G possibly damaging Het
Fras1 C T 5: 96,916,222 (GRCm39) R3419W probably damaging Het
Galc T A 12: 98,197,672 (GRCm39) probably null Het
Ghdc T C 11: 100,660,543 (GRCm39) E110G probably damaging Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
H2-T24 T C 17: 36,325,562 (GRCm39) T309A probably benign Het
Helb A C 10: 119,937,391 (GRCm39) F618V probably damaging Het
Hycc1 A C 5: 24,170,220 (GRCm39) S376R possibly damaging Het
Ifi211 A G 1: 173,735,262 (GRCm39) F56L probably damaging Het
Kntc1 T C 5: 123,950,160 (GRCm39) F1988L probably damaging Het
Mapk13 G A 17: 28,997,465 (GRCm39) S361N probably benign Het
Mapk3 A G 7: 126,363,408 (GRCm39) I146V probably benign Het
Megf6 G A 4: 154,338,295 (GRCm39) probably null Het
Mug1 G T 6: 121,838,092 (GRCm39) V441F probably benign Het
Mymk A G 2: 26,952,226 (GRCm39) S173P probably benign Het
Nox4 A G 7: 87,023,616 (GRCm39) T501A possibly damaging Het
Or13c7 C A 4: 43,854,624 (GRCm39) S105Y possibly damaging Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or52n2 T C 7: 104,542,104 (GRCm39) T244A possibly damaging Het
Prkcb C A 7: 121,888,678 (GRCm39) H37Q probably damaging Het
Rabggtb A G 3: 153,615,024 (GRCm39) F189L probably damaging Het
Setd1b T C 5: 123,281,471 (GRCm39) I75T unknown Het
Slc10a5 T A 3: 10,400,148 (GRCm39) R171* probably null Het
Slc12a4 A G 8: 106,680,484 (GRCm39) F211L probably damaging Het
Slc1a5 T A 7: 16,527,759 (GRCm39) W352R probably damaging Het
Slc22a27 C G 19: 7,843,303 (GRCm39) A359P probably damaging Het
St8sia4 A G 1: 95,555,460 (GRCm39) M190T probably damaging Het
Tmeff2 A G 1: 51,018,476 (GRCm39) M153V probably benign Het
Trappc12 T C 12: 28,796,696 (GRCm39) T279A probably damaging Het
Ubn1 G T 16: 4,895,818 (GRCm39) A955S probably benign Het
Usp24 T A 4: 106,239,500 (GRCm39) H1147Q possibly damaging Het
Vrk1 T A 12: 106,039,865 (GRCm39) probably null Het
Zdhhc25 T A 15: 88,485,365 (GRCm39) Y233* probably null Het
Zfp109 A G 7: 23,928,179 (GRCm39) V418A probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTCAGTCACTTGAACTG -3'
(R):5'- TGCTAGAGACTGGCTGGTATC -3'

Sequencing Primer
(F):5'- GAATCCAGTCAGATTCCTGGTGAC -3'
(R):5'- CTAGAGACTGGCTGGTATCTTGGTG -3'
Posted On 2016-07-22