Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Klhl18'

405425

Institutional Source

Beutler Lab

Gene Symbol

Klhl18

Ensembl Gene

ENSMUSG00000054792

Gene Name

kelch-like 18

Synonyms

MMRRC Submission

042879-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110425926-110476694 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 110436127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 335 (N335K)

Ref Sequence

ENSEMBL: ENSMUSP00000069674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]

AlphaFold

E9Q4F2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068025
AA Change: N335K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: N335K

Domain	Start	End	E-Value	Type
BTB	38	135	1.32e-29	SMART
BACK	140	242	1.67e-39	SMART
Kelch	289	336	1.78e-14	SMART
Kelch	337	383	2.64e-17	SMART
Kelch	384	430	2.18e-18	SMART
Kelch	431	477	9.27e-13	SMART
Kelch	478	524	3.34e-5	SMART
Kelch	525	571	1.22e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197336

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198164
AA Change: N340K

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: N340K

Domain	Start	End	E-Value	Type
BTB	38	135	1.32e-29	SMART
BACK	140	242	1.67e-39	SMART
Kelch	289	341	8.52e-12	SMART
Kelch	342	388	2.64e-17	SMART
Kelch	389	435	2.18e-18	SMART
Kelch	436	482	9.27e-13	SMART
Kelch	483	529	3.34e-5	SMART
Kelch	530	576	1.22e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198327

Predicted Effect

probably benign
Transcript: ENSMUST00000198400
AA Change: N270K

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: N270K

Domain	Start	End	E-Value	Type
Pfam:BTB	1	70	2.1e-15	PFAM
BACK	75	177	1.67e-39	SMART
Kelch	224	271	1.78e-14	SMART
Kelch	272	318	2.64e-17	SMART
Kelch	319	365	2.18e-18	SMART
Kelch	366	412	9.27e-13	SMART
Kelch	413	459	3.34e-5	SMART
Kelch	460	506	1.22e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199700

Predicted Effect

probably benign
Transcript: ENSMUST00000200256

Meta Mutation Damage Score

0.2012

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Klhl18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Klhl18	APN	9	110428686	missense	probably damaging	1.00
IGL01338:Klhl18	APN	9	110455433	missense	probably damaging	1.00
IGL01455:Klhl18	APN	9	110432443	missense	probably damaging	1.00
IGL01954:Klhl18	APN	9	110428866	missense	probably damaging	1.00
IGL01960:Klhl18	APN	9	110450746	missense	probably benign	0.25
IGL02195:Klhl18	APN	9	110438902	missense	possibly damaging	0.92
IGL02430:Klhl18	APN	9	110437401	missense	probably benign	0.25
IGL02629:Klhl18	APN	9	110429938	splice site	probably benign
Mixie	UTSW	9	110436062	missense	probably benign	0.00
R0389:Klhl18	UTSW	9	110428681	missense	probably benign	0.00
R1538:Klhl18	UTSW	9	110446747	missense	probably damaging	1.00
R1777:Klhl18	UTSW	9	110437401	missense	probably benign	0.25
R1966:Klhl18	UTSW	9	110476590	missense	probably benign	0.14
R2099:Klhl18	UTSW	9	110455418	missense	probably damaging	1.00
R3699:Klhl18	UTSW	9	110436066	missense	probably benign	0.06
R3911:Klhl18	UTSW	9	110436083	missense	probably damaging	1.00
R3950:Klhl18	UTSW	9	110428902	missense	probably damaging	1.00
R4197:Klhl18	UTSW	9	110429944	critical splice donor site	probably null
R4500:Klhl18	UTSW	9	110429966	missense	probably damaging	1.00
R4936:Klhl18	UTSW	9	110428961	missense	possibly damaging	0.88
R5298:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5301:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5407:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5433:Klhl18	UTSW	9	110436127	missense	possibly damaging	0.64
R5641:Klhl18	UTSW	9	110446828	missense	probably damaging	1.00
R6084:Klhl18	UTSW	9	110428727	missense	possibly damaging	0.52
R6279:Klhl18	UTSW	9	110436062	missense	probably benign	0.00
R6300:Klhl18	UTSW	9	110436062	missense	probably benign	0.00
R6425:Klhl18	UTSW	9	110446681	missense	possibly damaging	0.85
R6465:Klhl18	UTSW	9	110428920	missense	probably benign	0.21
R6521:Klhl18	UTSW	9	110428635	missense	possibly damaging	0.92
R6587:Klhl18	UTSW	9	110455426	missense	probably damaging	1.00
R6730:Klhl18	UTSW	9	110428911	missense	probably damaging	0.98
R7110:Klhl18	UTSW	9	110450765	missense	probably damaging	0.99
R7492:Klhl18	UTSW	9	110428775	nonsense	probably null
R7580:Klhl18	UTSW	9	110436050	missense	probably benign	0.00
R7598:Klhl18	UTSW	9	110446810	nonsense	probably null
R7789:Klhl18	UTSW	9	110439008	missense	unknown
R7988:Klhl18	UTSW	9	110476509	missense	possibly damaging	0.87
R8050:Klhl18	UTSW	9	110428761	missense	probably damaging	1.00
Z1176:Klhl18	UTSW	9	110437347	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- AGGACTTCCCAGGCATTTAC -3'
(R):5'- ATGTTCCGTATAGTCAATACCCAG -3'

Sequencing Primer
(F):5'- ACTTTATTATGTGCCCCTACATGG -3'
(R):5'- TAGTCAATACCCAGTAGCTGTGAGC -3'

Posted On

2016-07-22