Incidental Mutation 'R5296:Klhl18'
ID405425
Institutional Source Beutler Lab
Gene Symbol Klhl18
Ensembl Gene ENSMUSG00000054792
Gene Namekelch-like 18
Synonyms
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110425926-110476694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 110436127 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 335 (N335K)
Ref Sequence ENSEMBL: ENSMUSP00000069674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068025
AA Change: N335K

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792
AA Change: N335K

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect possibly damaging
Transcript: ENSMUST00000198164
AA Change: N340K

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792
AA Change: N340K

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198327
Predicted Effect probably benign
Transcript: ENSMUST00000198400
AA Change: N270K

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792
AA Change: N270K

DomainStartEndE-ValueType
Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199700
Predicted Effect probably benign
Transcript: ENSMUST00000200256
Meta Mutation Damage Score 0.2012 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr136 C T 17: 38,335,456 Q100* probably null Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Klhl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Klhl18 APN 9 110428686 missense probably damaging 1.00
IGL01338:Klhl18 APN 9 110455433 missense probably damaging 1.00
IGL01455:Klhl18 APN 9 110432443 missense probably damaging 1.00
IGL01954:Klhl18 APN 9 110428866 missense probably damaging 1.00
IGL01960:Klhl18 APN 9 110450746 missense probably benign 0.25
IGL02195:Klhl18 APN 9 110438902 missense possibly damaging 0.92
IGL02430:Klhl18 APN 9 110437401 missense probably benign 0.25
IGL02629:Klhl18 APN 9 110429938 splice site probably benign
Mixie UTSW 9 110436062 missense probably benign 0.00
R0389:Klhl18 UTSW 9 110428681 missense probably benign 0.00
R1538:Klhl18 UTSW 9 110446747 missense probably damaging 1.00
R1777:Klhl18 UTSW 9 110437401 missense probably benign 0.25
R1966:Klhl18 UTSW 9 110476590 missense probably benign 0.14
R2099:Klhl18 UTSW 9 110455418 missense probably damaging 1.00
R3699:Klhl18 UTSW 9 110436066 missense probably benign 0.06
R3911:Klhl18 UTSW 9 110436083 missense probably damaging 1.00
R3950:Klhl18 UTSW 9 110428902 missense probably damaging 1.00
R4197:Klhl18 UTSW 9 110429944 critical splice donor site probably null
R4500:Klhl18 UTSW 9 110429966 missense probably damaging 1.00
R4936:Klhl18 UTSW 9 110428961 missense possibly damaging 0.88
R5298:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5301:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5407:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5433:Klhl18 UTSW 9 110436127 missense possibly damaging 0.64
R5641:Klhl18 UTSW 9 110446828 missense probably damaging 1.00
R6084:Klhl18 UTSW 9 110428727 missense possibly damaging 0.52
R6279:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6300:Klhl18 UTSW 9 110436062 missense probably benign 0.00
R6425:Klhl18 UTSW 9 110446681 missense possibly damaging 0.85
R6465:Klhl18 UTSW 9 110428920 missense probably benign 0.21
R6521:Klhl18 UTSW 9 110428635 missense possibly damaging 0.92
R6587:Klhl18 UTSW 9 110455426 missense probably damaging 1.00
R6730:Klhl18 UTSW 9 110428911 missense probably damaging 0.98
R7110:Klhl18 UTSW 9 110450765 missense probably damaging 0.99
R7492:Klhl18 UTSW 9 110428775 nonsense probably null
R7580:Klhl18 UTSW 9 110436050 missense probably benign 0.00
R7598:Klhl18 UTSW 9 110446810 nonsense probably null
R7789:Klhl18 UTSW 9 110439008 missense unknown
R7988:Klhl18 UTSW 9 110476509 missense possibly damaging 0.87
R8050:Klhl18 UTSW 9 110428761 missense probably damaging 1.00
Z1176:Klhl18 UTSW 9 110437347 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGGACTTCCCAGGCATTTAC -3'
(R):5'- ATGTTCCGTATAGTCAATACCCAG -3'

Sequencing Primer
(F):5'- ACTTTATTATGTGCCCCTACATGG -3'
(R):5'- TAGTCAATACCCAGTAGCTGTGAGC -3'
Posted On2016-07-22