Mutagenetix > Incidental Mutations

Incidental Mutation 'R5296:Vmn2r67'

405414

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r67

Ensembl Gene

ENSMUSG00000095664

Gene Name

vomeronasal 2, receptor 67

Synonyms

EG620672

MMRRC Submission

042879-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85136240-85155902 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85137022 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 592 (S592P)

Ref Sequence

ENSEMBL: ENSMUSP00000126007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168730]

Predicted Effect

probably damaging
Transcript: ENSMUST00000168730
AA Change: S592P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126007
Gene: ENSMUSG00000095664
AA Change: S592P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:ANF_receptor	77	464	2.1e-31	PFAM
Pfam:NCD3G	507	559	4.8e-19	PFAM
Pfam:7tm_3	590	827	1.4e-53	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr136	C	T	17: 38,335,456	Q100*	probably null	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Vmn2r67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Vmn2r67	APN	7	85151930	missense	probably damaging	1.00
IGL01346:Vmn2r67	APN	7	85136919	missense	probably damaging	1.00
IGL01373:Vmn2r67	APN	7	85136626	missense	probably benign	0.10
IGL01674:Vmn2r67	APN	7	85136443	missense	probably damaging	1.00
IGL01978:Vmn2r67	APN	7	85151441	critical splice donor site	probably null
IGL02013:Vmn2r67	APN	7	85151655	missense	probably benign	0.09
IGL02115:Vmn2r67	APN	7	85151579	missense	probably damaging	0.99
IGL02250:Vmn2r67	APN	7	85155800	missense	probably benign
IGL02252:Vmn2r67	APN	7	85155800	missense	probably benign
IGL02328:Vmn2r67	APN	7	85150690	missense	probably benign	0.41
IGL02740:Vmn2r67	APN	7	85136610	missense	probably damaging	1.00
IGL02940:Vmn2r67	APN	7	85136743	missense	probably benign	0.07
IGL03237:Vmn2r67	APN	7	85149910	missense	probably damaging	1.00
R0512:Vmn2r67	UTSW	7	85150692	missense	probably damaging	1.00
R1029:Vmn2r67	UTSW	7	85136766	missense	probably damaging	1.00
R1193:Vmn2r67	UTSW	7	85151445	missense	probably damaging	0.98
R1282:Vmn2r67	UTSW	7	85136724	missense	probably benign
R1416:Vmn2r67	UTSW	7	85151616	missense	probably benign	0.06
R1429:Vmn2r67	UTSW	7	85152823	missense	possibly damaging	0.65
R1462:Vmn2r67	UTSW	7	85155838	missense	probably benign	0.00
R1462:Vmn2r67	UTSW	7	85155838	missense	probably benign	0.00
R1970:Vmn2r67	UTSW	7	85151805	missense	probably benign
R2229:Vmn2r67	UTSW	7	85152042	missense	probably benign	0.21
R2246:Vmn2r67	UTSW	7	85136556	missense	probably damaging	1.00
R2262:Vmn2r67	UTSW	7	85136974	missense	probably damaging	0.96
R2398:Vmn2r67	UTSW	7	85136713	missense	probably damaging	1.00
R4249:Vmn2r67	UTSW	7	85150514	splice site	probably null
R4666:Vmn2r67	UTSW	7	85150623	missense	probably benign
R4669:Vmn2r67	UTSW	7	85150524	missense	probably benign	0.11
R4966:Vmn2r67	UTSW	7	85136385	missense	probably damaging	1.00
R5264:Vmn2r67	UTSW	7	85152245	missense	probably damaging	1.00
R5327:Vmn2r67	UTSW	7	85136490	missense	probably damaging	1.00
R5401:Vmn2r67	UTSW	7	85136557	missense	probably damaging	1.00
R5510:Vmn2r67	UTSW	7	85151815	missense	probably benign	0.39
R5574:Vmn2r67	UTSW	7	85151891	missense	probably benign	0.00
R5643:Vmn2r67	UTSW	7	85149943	nonsense	probably null
R5914:Vmn2r67	UTSW	7	85151836	missense	probably damaging	1.00
R6248:Vmn2r67	UTSW	7	85150560	missense	probably damaging	0.99
R6291:Vmn2r67	UTSW	7	85149934	missense	possibly damaging	0.88
R6309:Vmn2r67	UTSW	7	85151916	missense	probably benign
R6442:Vmn2r67	UTSW	7	85155838	missense	possibly damaging	0.82
R6665:Vmn2r67	UTSW	7	85136692	missense	probably benign	0.07
R6701:Vmn2r67	UTSW	7	85152815	missense	probably damaging	1.00
R6848:Vmn2r67	UTSW	7	85152632	missense	probably benign	0.00
R6852:Vmn2r67	UTSW	7	85152153	missense	probably damaging	0.99
R6991:Vmn2r67	UTSW	7	85155745	missense	possibly damaging	0.55
R7143:Vmn2r67	UTSW	7	85152638	missense	probably benign
R7197:Vmn2r67	UTSW	7	85136566	missense	possibly damaging	0.77
R7393:Vmn2r67	UTSW	7	85155878	missense	probably null	0.87
R7420:Vmn2r67	UTSW	7	85136736	missense	possibly damaging	0.52
R7622:Vmn2r67	UTSW	7	85136454	missense	probably damaging	1.00
R7664:Vmn2r67	UTSW	7	85155811	missense	probably benign	0.21
R7665:Vmn2r67	UTSW	7	85151988	nonsense	probably null
R7896:Vmn2r67	UTSW	7	85136712	missense	probably damaging	1.00
R7913:Vmn2r67	UTSW	7	85151828	missense	possibly damaging	0.87
R8026:Vmn2r67	UTSW	7	85136716	missense	probably damaging	1.00
R8114:Vmn2r67	UTSW	7	85155889	missense	probably benign	0.01
R8317:Vmn2r67	UTSW	7	85136626	missense	probably benign	0.10
R8363:Vmn2r67	UTSW	7	85155761	missense	probably benign	0.00
R8421:Vmn2r67	UTSW	7	85136685	missense	probably damaging	0.98
R8444:Vmn2r67	UTSW	7	85136646	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCGGCTGCAGGATACAGATG -3'
(R):5'- GATGCATGTCTAACTTAGCTATGAC -3'

Sequencing Primer
(F):5'- TGACCGTAGTGGGATGACC -3'
(R):5'- ATGTCTAACTTAGCTATGACATTTCC -3'

Posted On

2016-07-22