Incidental Mutation 'R5296:Olfr136'
ID405443
Institutional Source Beutler Lab
Gene Symbol Olfr136
Ensembl Gene ENSMUSG00000096840
Gene Nameolfactory receptor 136
SynonymsGA_x6K02T2PSCP-2779375-2780313, MOR256-7
MMRRC Submission 042879-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5296 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38329831-38336643 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 38335456 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000149856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
Predicted Effect probably null
Transcript: ENSMUST00000077203
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: Q100*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000208525
AA Change: Q100*
Predicted Effect probably null
Transcript: ENSMUST00000208539
AA Change: Q100*
Predicted Effect probably null
Transcript: ENSMUST00000214035
AA Change: Q100*
Predicted Effect probably null
Transcript: ENSMUST00000216963
AA Change: Q100*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apobr A C 7: 126,588,024 D89A probably damaging Het
Bhlhe41 C T 6: 145,862,968 probably benign Het
Cacna1s G A 1: 136,095,785 V674M probably benign Het
Cavin2 T C 1: 51,289,870 probably null Het
Cd300lb T C 11: 114,924,937 S106G possibly damaging Het
Ceacam15 A G 7: 16,673,196 V132A probably benign Het
Ddi2 G T 4: 141,684,765 Q279K probably benign Het
Dnah11 A G 12: 117,883,416 V4304A probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epsti1 T A 14: 77,904,650 H55Q probably benign Het
Flad1 T C 3: 89,411,196 T17A probably damaging Het
Fzd2 C T 11: 102,606,155 T475M probably damaging Het
Gemin5 C A 11: 58,130,061 W1099L probably damaging Het
Gm8979 A T 7: 106,081,848 noncoding transcript Het
Gm9892 T C 8: 52,196,929 noncoding transcript Het
Gmeb2 A G 2: 181,255,986 probably benign Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Hltf T C 3: 20,108,112 S825P probably damaging Het
Kcnh3 A T 15: 99,241,939 Q902L probably null Het
Kcnt2 C T 1: 140,609,615 P1037L probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lama5 A C 2: 180,193,801 L1253R probably damaging Het
Lancl2 T G 6: 57,724,582 S230A probably benign Het
Lmcd1 A G 6: 112,315,588 M134V probably damaging Het
Lrrc23 C A 6: 124,774,482 A205S probably damaging Het
Mfsd13b T A 7: 120,991,738 I234N probably damaging Het
Mroh3 A G 1: 136,196,323 S386P probably damaging Het
Mylk3 A C 8: 85,355,431 F313V possibly damaging Het
Myo9b A T 8: 71,333,388 Q643L possibly damaging Het
Nacad T C 11: 6,605,745 S2G unknown Het
Olfr1269 A T 2: 90,118,699 W300R probably damaging Het
Olfr419 G T 1: 174,250,756 T57K possibly damaging Het
Olfr908 T C 9: 38,516,116 F28S probably damaging Het
Pkd1 T C 17: 24,576,074 V2245A probably damaging Het
Pkdrej G A 15: 85,817,118 T1539I possibly damaging Het
Plch2 G T 4: 154,989,999 probably null Het
Pygm G A 19: 6,384,579 R34H probably damaging Het
Rgs12 T C 5: 35,021,104 probably benign Het
Ruvbl1 T C 6: 88,485,908 I338T probably damaging Het
Sapcd1 T A 17: 35,026,731 Q104L probably damaging Het
Satb2 T C 1: 56,796,907 E575G probably damaging Het
Sema6b T A 17: 56,127,091 probably null Het
Slc25a11 T C 11: 70,646,185 N15D probably damaging Het
Slc26a6 C T 9: 108,860,646 T526M probably damaging Het
Tcaf3 G T 6: 42,587,510 T906K possibly damaging Het
Thbd A T 2: 148,406,983 C322S probably damaging Het
Traf2 A G 2: 25,520,440 L399P probably damaging Het
Troap T A 15: 99,078,817 V274D probably damaging Het
Utrn G A 10: 12,401,355 T3406M probably damaging Het
Uts2 G T 4: 150,999,051 A40S possibly damaging Het
Vmn2r109 T A 17: 20,554,341 I251F possibly damaging Het
Vmn2r67 A G 7: 85,137,022 S592P probably damaging Het
Vps13b T G 15: 35,876,413 W2797G probably damaging Het
Ythdf1 A T 2: 180,912,188 M51K probably damaging Het
Zfp60 T A 7: 27,738,530 probably benign Het
Zfp882 T A 8: 71,914,360 F344I probably damaging Het
Other mutations in Olfr136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Olfr136 APN 17 38335957 missense probably benign 0.00
IGL01787:Olfr136 APN 17 38335579 missense probably damaging 0.98
IGL02480:Olfr136 APN 17 38335423 missense probably benign 0.32
IGL02603:Olfr136 APN 17 38335513 missense probably damaging 1.00
IGL03122:Olfr136 APN 17 38335301 missense probably benign 0.01
BB009:Olfr136 UTSW 17 38335255 missense probably benign 0.01
BB019:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R0295:Olfr136 UTSW 17 38335291 missense probably damaging 1.00
R0684:Olfr136 UTSW 17 38335844 missense probably benign 0.11
R1874:Olfr136 UTSW 17 38335969 missense probably damaging 1.00
R3436:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R3437:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R4714:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4715:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4716:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4878:Olfr136 UTSW 17 38335627 missense probably benign
R5370:Olfr136 UTSW 17 38335444 nonsense probably null
R5413:Olfr136 UTSW 17 38335624 missense probably benign 0.03
R5988:Olfr136 UTSW 17 38336020 missense probably damaging 1.00
R6156:Olfr136 UTSW 17 38335173 missense probably damaging 0.99
R6550:Olfr136 UTSW 17 38336005 missense possibly damaging 0.65
R7395:Olfr136 UTSW 17 38335864 nonsense probably null
R7417:Olfr136 UTSW 17 38335292 missense probably damaging 1.00
R7746:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7747:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7821:Olfr136 UTSW 17 38335964 missense probably benign 0.13
R7932:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R8409:Olfr136 UTSW 17 38335306 missense probably benign 0.09
V5088:Olfr136 UTSW 17 38335159 start codon destroyed probably null 0.99
Z1176:Olfr136 UTSW 17 38335352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCGCCATCATTCTGGTG -3'
(R):5'- TCCAGTTTATGTATGCCACACAATG -3'

Sequencing Primer
(F):5'- GGTGTCAACCTTAGACCCTCG -3'
(R):5'- GGCAATTGTAATGTAAGTGTAGCCTC -3'
Posted On2016-07-22