Mutagenetix > Incidental Mutation

Incidental Mutation 'R5296:Olfr136'

405443

Institutional Source

Beutler Lab

Gene Symbol

Olfr136

Ensembl Gene

ENSMUSG00000096840

Gene Name

olfactory receptor 136

Synonyms

GA_x6K02T2PSCP-2779375-2780313, MOR256-7

MMRRC Submission

042879-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5296 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38329831-38336643 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 38335456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 100 (Q100*)

Ref Sequence

ENSEMBL: ENSMUSP00000149856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]

AlphaFold

Q8VG72

Predicted Effect

probably null
Transcript: ENSMUST00000077203
AA Change: Q100*

SMART Domains

Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: Q100*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.6e-48	PFAM
Pfam:7tm_1	41	290	7.1e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000208525
AA Change: Q100*

Predicted Effect

probably null
Transcript: ENSMUST00000208539
AA Change: Q100*

Predicted Effect

probably null
Transcript: ENSMUST00000214035
AA Change: Q100*

Predicted Effect

probably null
Transcript: ENSMUST00000216963
AA Change: Q100*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.9%
20x: 96.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apobr	A	C	7: 126,588,024	D89A	probably damaging	Het
Bhlhe41	C	T	6: 145,862,968		probably benign	Het
Cacna1s	G	A	1: 136,095,785	V674M	probably benign	Het
Cavin2	T	C	1: 51,289,870		probably null	Het
Cd300lb	T	C	11: 114,924,937	S106G	possibly damaging	Het
Ceacam15	A	G	7: 16,673,196	V132A	probably benign	Het
Ddi2	G	T	4: 141,684,765	Q279K	probably benign	Het
Dnah11	A	G	12: 117,883,416	V4304A	probably damaging	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epsti1	T	A	14: 77,904,650	H55Q	probably benign	Het
Flad1	T	C	3: 89,411,196	T17A	probably damaging	Het
Fzd2	C	T	11: 102,606,155	T475M	probably damaging	Het
Gemin5	C	A	11: 58,130,061	W1099L	probably damaging	Het
Gm8979	A	T	7: 106,081,848		noncoding transcript	Het
Gm9892	T	C	8: 52,196,929		noncoding transcript	Het
Gmeb2	A	G	2: 181,255,986		probably benign	Het
Grip1	A	G	10: 119,929,928	E55G	probably damaging	Het
Hltf	T	C	3: 20,108,112	S825P	probably damaging	Het
Kcnh3	A	T	15: 99,241,939	Q902L	probably null	Het
Kcnt2	C	T	1: 140,609,615	P1037L	probably damaging	Het
Klhl18	G	C	9: 110,436,127	N335K	possibly damaging	Het
Lama5	A	C	2: 180,193,801	L1253R	probably damaging	Het
Lancl2	T	G	6: 57,724,582	S230A	probably benign	Het
Lmcd1	A	G	6: 112,315,588	M134V	probably damaging	Het
Lrrc23	C	A	6: 124,774,482	A205S	probably damaging	Het
Mfsd13b	T	A	7: 120,991,738	I234N	probably damaging	Het
Mroh3	A	G	1: 136,196,323	S386P	probably damaging	Het
Mylk3	A	C	8: 85,355,431	F313V	possibly damaging	Het
Myo9b	A	T	8: 71,333,388	Q643L	possibly damaging	Het
Nacad	T	C	11: 6,605,745	S2G	unknown	Het
Olfr1269	A	T	2: 90,118,699	W300R	probably damaging	Het
Olfr419	G	T	1: 174,250,756	T57K	possibly damaging	Het
Olfr908	T	C	9: 38,516,116	F28S	probably damaging	Het
Pkd1	T	C	17: 24,576,074	V2245A	probably damaging	Het
Pkdrej	G	A	15: 85,817,118	T1539I	possibly damaging	Het
Plch2	G	T	4: 154,989,999		probably null	Het
Pygm	G	A	19: 6,384,579	R34H	probably damaging	Het
Rgs12	T	C	5: 35,021,104		probably benign	Het
Ruvbl1	T	C	6: 88,485,908	I338T	probably damaging	Het
Sapcd1	T	A	17: 35,026,731	Q104L	probably damaging	Het
Satb2	T	C	1: 56,796,907	E575G	probably damaging	Het
Sema6b	T	A	17: 56,127,091		probably null	Het
Slc25a11	T	C	11: 70,646,185	N15D	probably damaging	Het
Slc26a6	C	T	9: 108,860,646	T526M	probably damaging	Het
Tcaf3	G	T	6: 42,587,510	T906K	possibly damaging	Het
Thbd	A	T	2: 148,406,983	C322S	probably damaging	Het
Traf2	A	G	2: 25,520,440	L399P	probably damaging	Het
Troap	T	A	15: 99,078,817	V274D	probably damaging	Het
Utrn	G	A	10: 12,401,355	T3406M	probably damaging	Het
Uts2	G	T	4: 150,999,051	A40S	possibly damaging	Het
Vmn2r109	T	A	17: 20,554,341	I251F	possibly damaging	Het
Vmn2r67	A	G	7: 85,137,022	S592P	probably damaging	Het
Vps13b	T	G	15: 35,876,413	W2797G	probably damaging	Het
Ythdf1	A	T	2: 180,912,188	M51K	probably damaging	Het
Zfp60	T	A	7: 27,738,530		probably benign	Het
Zfp882	T	A	8: 71,914,360	F344I	probably damaging	Het

Other mutations in Olfr136

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01712:Olfr136	APN	17	38335957	missense	probably benign	0.00
IGL01787:Olfr136	APN	17	38335579	missense	probably damaging	0.98
IGL02480:Olfr136	APN	17	38335423	missense	probably benign	0.32
IGL02603:Olfr136	APN	17	38335513	missense	probably damaging	1.00
IGL03122:Olfr136	APN	17	38335301	missense	probably benign	0.01
BB009:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
BB019:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R0295:Olfr136	UTSW	17	38335291	missense	probably damaging	1.00
R0684:Olfr136	UTSW	17	38335844	missense	probably benign	0.11
R1874:Olfr136	UTSW	17	38335969	missense	probably damaging	1.00
R3436:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R3437:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R4714:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4715:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4716:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4878:Olfr136	UTSW	17	38335627	missense	probably benign
R5370:Olfr136	UTSW	17	38335444	nonsense	probably null
R5413:Olfr136	UTSW	17	38335624	missense	probably benign	0.03
R5988:Olfr136	UTSW	17	38336020	missense	probably damaging	1.00
R6156:Olfr136	UTSW	17	38335173	missense	probably damaging	0.99
R6550:Olfr136	UTSW	17	38336005	missense	possibly damaging	0.65
R7395:Olfr136	UTSW	17	38335864	nonsense	probably null
R7417:Olfr136	UTSW	17	38335292	missense	probably damaging	1.00
R7746:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7747:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7821:Olfr136	UTSW	17	38335964	missense	probably benign	0.13
R7932:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R8409:Olfr136	UTSW	17	38335306	missense	probably benign	0.09
R8911:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8912:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8913:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8914:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8968:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9006:Olfr136	UTSW	17	38335832	missense	possibly damaging	0.84
R9044:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9110:Olfr136	UTSW	17	38335543	missense	probably damaging	1.00
R9155:Olfr136	UTSW	17	38335333	missense	probably damaging	0.99
R9279:Olfr136	UTSW	17	38335523	missense	probably damaging	0.99
R9289:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9295:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9317:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9318:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9348:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9409:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9410:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9411:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9412:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9413:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9512:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9522:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9524:Olfr136	UTSW	17	38335649	nonsense	probably null
R9547:Olfr136	UTSW	17	38335450	missense	possibly damaging	0.80
R9580:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
V5088:Olfr136	UTSW	17	38335159	start codon destroyed	probably null	0.99
Z1176:Olfr136	UTSW	17	38335352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCGCCATCATTCTGGTG -3'
(R):5'- TCCAGTTTATGTATGCCACACAATG -3'

Sequencing Primer
(F):5'- GGTGTCAACCTTAGACCCTCG -3'
(R):5'- GGCAATTGTAATGTAAGTGTAGCCTC -3'

Posted On

2016-07-22