Incidental Mutation 'R4904:Duox1'
ID430226
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 042507-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4904 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122320864 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 310 (Y310N)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: Y310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: Y310N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Meta Mutation Damage Score 0.9437 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.1%
Validation Efficiency 94% (82/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 T G 4: 130,012,539 I920S possibly damaging Het
Afap1l1 A G 18: 61,738,715 I556T probably benign Het
Ankfy1 C A 11: 72,752,105 H665N probably benign Het
Aqp9 A C 9: 71,162,403 probably benign Het
Arhgap21 A G 2: 20,850,061 S1497P probably benign Het
Armc7 A G 11: 115,488,974 D166G probably damaging Het
Arrdc1 C A 2: 24,926,664 V167F possibly damaging Het
AW822073 T A 10: 58,223,487 R482* probably null Het
Col6a3 A T 1: 90,801,442 I1259N probably damaging Het
Coq8a C T 1: 180,178,603 R207Q probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcbld1 C T 10: 52,319,970 Q425* probably null Het
Def8 A G 8: 123,461,480 N445D probably damaging Het
Dicer1 C T 12: 104,713,066 V551I probably benign Het
Dst A T 1: 34,169,798 T800S probably damaging Het
Dtl A T 1: 191,568,345 C136S probably damaging Het
Ebf1 T C 11: 44,869,169 F211S probably damaging Het
Gm44501 A T 17: 40,578,993 I133F possibly damaging Het
Gm6625 T C 8: 89,146,751 noncoding transcript Het
Golgb1 A T 16: 36,893,386 D243V probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtf2a1l G A 17: 88,690,043 probably null Het
Herc2 T C 7: 56,157,486 F2471L probably damaging Het
Hfe A T 13: 23,708,054 I109N probably damaging Het
Hrg A G 16: 22,951,250 E43G probably benign Het
Hspa1a T C 17: 34,970,451 D492G probably damaging Het
Itgb8 T C 12: 119,170,871 D487G probably benign Het
Jag1 A G 2: 137,087,142 V798A probably damaging Het
Kcnq5 A G 1: 21,424,100 V501A probably damaging Het
Kntc1 T C 5: 123,778,333 V743A possibly damaging Het
Ly86 G T 13: 37,415,520 V126F possibly damaging Het
Med26 A T 8: 72,496,847 L136H probably damaging Het
Mpp3 T C 11: 102,000,587 D575G probably benign Het
Myoc G A 1: 162,639,425 M54I probably benign Het
Nlrp1c-ps A G 11: 71,242,628 noncoding transcript Het
Olfr111 A G 17: 37,530,631 Y218C probably damaging Het
Olfr1418 C T 19: 11,855,867 V29M possibly damaging Het
Olfr574 A G 7: 102,949,065 Y190C probably damaging Het
Pak7 A T 2: 136,083,347 D678E probably benign Het
Pcdhb12 T C 18: 37,437,856 V685A possibly damaging Het
Pcdhga2 A G 18: 37,669,879 T259A possibly damaging Het
Pde6a A T 18: 61,265,034 M702L probably benign Het
Pigq A G 17: 25,931,060 probably benign Het
Polrmt A G 10: 79,746,551 M1T probably null Het
Ptch1 A C 13: 63,523,004 I904S probably damaging Het
Rflnb A T 11: 76,022,138 C141* probably null Het
Rilpl1 C A 5: 124,514,744 probably null Het
Rpgrip1 T C 14: 52,121,087 S217P possibly damaging Het
Rpgrip1 A T 14: 52,160,129 I1292F probably damaging Het
Sema3a A C 5: 13,581,098 Y534S probably damaging Het
Sez6 A G 11: 77,975,254 Y736C probably damaging Het
Shank1 G T 7: 44,334,040 probably benign Het
Slc45a4 G A 15: 73,586,842 S294F probably benign Het
Slc9a8 A G 2: 167,471,396 I393V possibly damaging Het
Sod1 T A 16: 90,222,844 F46Y probably damaging Het
Sult1b1 T C 5: 87,535,053 D11G probably benign Het
Syn3 T G 10: 86,467,086 K68N possibly damaging Het
Taar8c C T 10: 24,101,249 V222I probably benign Het
Tbx20 T C 9: 24,758,833 K235E probably damaging Het
Tcaf3 C A 6: 42,593,997 E274* probably null Het
Tll1 A T 8: 64,070,199 M493K probably benign Het
Tmem236 T A 2: 14,195,992 S123T probably benign Het
Trim33 T C 3: 103,331,647 V647A possibly damaging Het
Tspear T A 10: 77,869,655 Y296N possibly damaging Het
Vps13d T C 4: 145,155,445 K1187E probably damaging Het
Xpot C T 10: 121,617,178 V52I probably benign Het
Zdhhc3 A T 9: 123,100,387 V61E probably damaging Het
Zfp955a A T 17: 33,242,188 C323* probably null Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCTCGTGTCTACCTGTAAG -3'
(R):5'- CTGAGAACTCCTGAAGGCAG -3'

Sequencing Primer
(F):5'- TCAGGGCTAGTCCTACACACG -3'
(R):5'- GAACTCCTGAAGGCAGATTTTTATC -3'
Posted On2016-09-26