Mutagenetix > Incidental Mutations

Incidental Mutation 'R0550:Aqr'

45066

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

038742-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0550 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 114132976 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 664 (N664K)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: N664K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N664K

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: N664K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N664K

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126701

Meta Mutation Damage Score

0.1972

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

99% (76/77)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	T	11: 110,293,840	Y947N	probably damaging	Het
Acss3	C	A	10: 107,053,471	G163C	probably damaging	Het
Adcy10	A	G	1: 165,565,315	T1367A	probably benign	Het
Adcy2	A	T	13: 68,982,361	S136T	probably benign	Het
Ahdc1	G	A	4: 133,063,037	V530I	probably benign	Het
Aldh16a1	C	T	7: 45,146,229		probably null	Het
Ankrd36	T	C	11: 5,607,429		probably null	Het
Atp6v1c1	T	C	15: 38,682,929		probably benign	Het
Atp8b2	C	T	3: 89,959,061		probably benign	Het
Bbx	T	C	16: 50,274,533		probably benign	Het
Bmper	T	A	9: 23,373,885	D243E	probably benign	Het
Casz1	GCCACCACCACCACCACCACCAC	GCCACCACCACCACCACCAC	4: 148,952,284		probably benign	Het
Catsperd	T	C	17: 56,663,427		probably null	Het
Ccdc92b	T	A	11: 74,629,945		probably null	Het
Cd2bp2	G	T	7: 127,193,824	T342K	probably damaging	Het
Clrn3	T	A	7: 135,528,425	I27F	possibly damaging	Het
Cnih3	TTGACGAG	T	1: 181,406,477		probably null	Het
Cntnap3	T	C	13: 64,762,000	T764A	possibly damaging	Het
Cttnbp2	T	G	6: 18,435,309	K183N	possibly damaging	Het
Cwc27	G	A	13: 104,804,949	P155L	probably damaging	Het
Dcaf10	T	C	4: 45,372,753	S389P	probably benign	Het
Ddx18	T	C	1: 121,555,375	K561E	probably benign	Het
Dkk3	A	G	7: 112,158,245	F51L	probably damaging	Het
Dnaic1	C	T	4: 41,596,274	R20*	probably null	Het
Dr1	G	A	5: 108,269,605	G6S	probably benign	Het
Dync2h1	A	T	9: 7,120,954		probably null	Het
Eif3l	A	G	15: 79,076,867	Y16C	probably damaging	Het
Epb41	A	G	4: 131,975,613	I464T	probably damaging	Het
Erc2	A	G	14: 28,271,651	K546E	possibly damaging	Het
F830045P16Rik	T	C	2: 129,463,509	D315G	probably damaging	Het
Fads6	A	G	11: 115,296,677	I64T	probably benign	Het
Fshr	T	C	17: 89,045,125	N107S	probably benign	Het
Gbp11	A	T	5: 105,343,750	N60K	probably benign	Het
Gm2a	C	T	11: 55,103,665	Q54*	probably null	Het
Hydin	A	G	8: 110,587,775	D4297G	probably benign	Het
Il6st	G	A	13: 112,475,114		probably null	Het
Inpp4b	T	A	8: 81,997,337	H499Q	probably benign	Het
Kif5c	A	G	2: 49,758,912	K956R	possibly damaging	Het
Krt74	G	A	15: 101,760,679		noncoding transcript	Het
Map3k9	A	T	12: 81,725,781	L649Q	probably damaging	Het
Mdn1	A	G	4: 32,730,479	D2871G	probably benign	Het
Mylk4	T	C	13: 32,716,666	T294A	probably benign	Het
Nbeal2	C	T	9: 110,642,158	V252I	probably benign	Het
Nectin3	A	G	16: 46,458,820	I265T	possibly damaging	Het
Olfr1065	A	T	2: 86,445,876	Y35*	probably null	Het
Olfr1109	G	T	2: 87,093,129	H89Q	probably benign	Het
Olfr1259	A	G	2: 89,943,389	I242T	probably damaging	Het
Olfr1447	A	T	19: 12,901,800		probably null	Het
Olfr181	A	G	16: 58,926,385	F62S	probably damaging	Het
Olfr554	G	A	7: 102,640,950	E235K	possibly damaging	Het
Olfr910	T	A	9: 38,539,380	C162S	probably damaging	Het
Opn1sw	A	T	6: 29,380,204	L71Q	probably damaging	Het
Pced1a	G	A	2: 130,419,633	P367S	probably benign	Het
Pkhd1	A	T	1: 20,347,223	M2568K	probably null	Het
Pla2r1	A	G	2: 60,425,350		probably null	Het
Plpp1	T	C	13: 112,834,985	I62T	probably benign	Het
Polr3g	G	A	13: 81,694,773	T41I	probably damaging	Het
Ptch2	T	C	4: 117,096,433		probably benign	Het
Sema4g	A	T	19: 44,997,665	H315L	probably benign	Het
Setd1b	G	T	5: 123,157,660	S1097I	unknown	Het
Sfxn4	A	G	19: 60,850,945		probably benign	Het
Sh3tc1	T	C	5: 35,699,784	E1237G	probably damaging	Het
Slc25a38	A	T	9: 120,123,643	N287I	probably benign	Het
Slc25a48	A	G	13: 56,448,998	T31A	probably benign	Het
Slc6a12	G	A	6: 121,356,918	V238I	probably damaging	Het
Slc8b1	A	G	5: 120,531,155		probably benign	Het
Slco4c1	A	C	1: 96,867,859	V158G	probably damaging	Het
Sptbn4	T	C	7: 27,364,378	T2208A	probably benign	Het
Srebf1	G	A	11: 60,201,676	T843I	probably benign	Het
Srl	A	G	16: 4,487,565	W101R	probably damaging	Het
St6galnac4	T	A	2: 32,594,019	C76*	probably null	Het
Tdrd3	C	A	14: 87,486,220	T290K	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trpm3	A	G	19: 22,987,812	E1547G	probably damaging	Het
Ubn1	A	G	16: 5,062,620		probably null	Het
Usp10	T	A	8: 119,947,801	I456K	probably damaging	Het
Usp6nl	A	G	2: 6,400,323		probably benign	Het
Vit	T	A	17: 78,624,793	V443E	possibly damaging	Het
Whamm	G	A	7: 81,586,224	V392I	possibly damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp352	A	T	4: 90,224,690	T356S	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTTCAAGGGACATTGGCACGGC -3'
(R):5'- GGACAGTTCAGTCACGGGGTATTG -3'

Sequencing Primer
(F):5'- TGCCAAGTTCACTGGAGCTG -3'
(R):5'- CATTGACTTGCCATTTCTATGAAGG -3'

Posted On

2013-06-11