Incidental Mutation 'R5876:Cdh5'
ID455536
Institutional Source Beutler Lab
Gene Symbol Cdh5
Ensembl Gene ENSMUSG00000031871
Gene Namecadherin 5
SynonymsVECD, VEcad, VE-cadherin, CD144, VE-Cad, 7B4/cadherin-5, VEC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5876 (G1)
Quality Score157
Status Not validated
Chromosome8
Chromosomal Location104101625-104144511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104142577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 645 (Y645C)
Ref Sequence ENSEMBL: ENSMUSP00000034339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034339]
PDB Structure
NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034339
AA Change: Y645C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034339
Gene: ENSMUSG00000031871
AA Change: Y645C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 66 147 3.03e-10 SMART
CA 171 254 3.19e-18 SMART
CA 278 370 7.92e-14 SMART
CA 392 476 1.09e-16 SMART
CA 499 583 2.16e-6 SMART
transmembrane domain 598 620 N/A INTRINSIC
Pfam:Cadherin_C 625 776 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous inactivation or cytosolic truncation of this gene causes embryonic growth retardation, abnormal somite and heart development, impaired remodeling and maturation of endothelial cells, increased endothelial apoptosis and severe vascular defects leading to embryonic death at midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Cdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Cdh5 APN 8 104137817 missense probably damaging 1.00
IGL02506:Cdh5 APN 8 104137822 missense probably damaging 1.00
IGL02737:Cdh5 APN 8 104142928 missense probably damaging 1.00
IGL03287:Cdh5 APN 8 104128115 missense probably damaging 1.00
IGL03297:Cdh5 APN 8 104128199 missense probably damaging 1.00
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0126:Cdh5 UTSW 8 104140682 critical splice acceptor site probably null
R0167:Cdh5 UTSW 8 104136735 missense possibly damaging 0.51
R0592:Cdh5 UTSW 8 104130902 splice site probably null
R1760:Cdh5 UTSW 8 104128169 missense probably benign
R1826:Cdh5 UTSW 8 104131091 missense possibly damaging 0.93
R1827:Cdh5 UTSW 8 104112909 missense possibly damaging 0.96
R1840:Cdh5 UTSW 8 104126616 nonsense probably null
R1993:Cdh5 UTSW 8 104137815 missense probably damaging 0.97
R2219:Cdh5 UTSW 8 104142906 missense possibly damaging 0.94
R2239:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R2281:Cdh5 UTSW 8 104125733 missense probably damaging 1.00
R2380:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R3418:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3419:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3429:Cdh5 UTSW 8 104130968 missense possibly damaging 0.91
R4491:Cdh5 UTSW 8 104113040 missense probably damaging 1.00
R4823:Cdh5 UTSW 8 104142669 missense probably benign 0.00
R5071:Cdh5 UTSW 8 104140702 missense probably damaging 0.99
R5265:Cdh5 UTSW 8 104142739 missense probably benign 0.00
R5383:Cdh5 UTSW 8 104137847 missense probably benign 0.17
R5447:Cdh5 UTSW 8 104129362 missense probably damaging 0.99
R5580:Cdh5 UTSW 8 104125494 nonsense probably null
R5934:Cdh5 UTSW 8 104138268 missense probably benign 0.00
R6378:Cdh5 UTSW 8 104126536 splice site probably null
R7110:Cdh5 UTSW 8 104140768 missense probably damaging 1.00
R7141:Cdh5 UTSW 8 104113001 missense probably benign 0.20
R7324:Cdh5 UTSW 8 104142793 missense probably damaging 1.00
R7658:Cdh5 UTSW 8 104129401 critical splice donor site probably null
R7806:Cdh5 UTSW 8 104140816 missense probably damaging 0.98
R7811:Cdh5 UTSW 8 104125603 missense possibly damaging 0.72
R7958:Cdh5 UTSW 8 104113017 missense probably benign 0.01
R8270:Cdh5 UTSW 8 104113040 missense probably benign 0.11
X0067:Cdh5 UTSW 8 104142537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGCCAAATCAAATCAGTTC -3'
(R):5'- TTCACGTCGATCATGGTGGC -3'

Sequencing Primer
(F):5'- CAGTTCGCCCAATTATAGTAGTGGC -3'
(R):5'- GTCGATCATGGTGGCCATCTC -3'
Posted On2017-02-10