Incidental Mutation 'R5876:Gabrg2'
ID 455544
Institutional Source Beutler Lab
Gene Symbol Gabrg2
Ensembl Gene ENSMUSG00000020436
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Synonyms gamma2, Gabrg-2, GABAA-R
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R5876 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 41910203-42000857 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41968820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 202 (S202P)
Ref Sequence ENSEMBL: ENSMUSP00000104913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070725] [ENSMUST00000070735] [ENSMUST00000109290]
AlphaFold P22723
Predicted Effect probably damaging
Transcript: ENSMUST00000070725
AA Change: S202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064739
Gene: ENSMUSG00000020436
AA Change: S202P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.7e-55 PFAM
Pfam:Neur_chan_memb 278 408 1.8e-46 PFAM
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070735
AA Change: S202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063812
Gene: ENSMUSG00000020436
AA Change: S202P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 2.9e-53 PFAM
Pfam:Neur_chan_memb 278 419 2.2e-38 PFAM
transmembrane domain 450 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109290
AA Change: S202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104913
Gene: ENSMUSG00000020436
AA Change: S202P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Neur_chan_LBD 65 271 1.2e-55 PFAM
Pfam:Neur_chan_memb 278 381 4.3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155032
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a gamma-aminobutyric acid (GABA)-A receptor subunit, which is a member of the ligand-gated ion channel family. GABA is the major inhibitory neurotransmitter in the adult central nervous system, and conversely exhibits an excitatory function during development. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. This gene encodes one of three gamma subunits in mammals, which contain the binding site for benzodiazepine drugs. Several mutations in this gene are associated with epileptic seizures, and genetic knockdown is associated with anxiety behavior. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded postnatal growth, impaired sensorimotor function, and greatly reduced lifespan. Heterozygotes show enhanced anxiety-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 (GRCm38) D64G possibly damaging Het
Ano2 T A 6: 126,039,279 (GRCm38) M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 (GRCm38) T69A probably damaging Het
Asap2 T A 12: 21,212,809 (GRCm38) N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 (GRCm38) N23Y probably benign Het
Cbr4 G A 8: 61,490,593 (GRCm38) G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 (GRCm38) C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 (GRCm38) I201N probably damaging Het
Cdh5 A G 8: 104,142,577 (GRCm38) Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 (GRCm38) V518I probably damaging Het
Clca4b T C 3: 144,912,060 (GRCm38) T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 (GRCm38) S204R probably damaging Het
Dcaf1 T C 9: 106,863,650 (GRCm38) W1279R probably damaging Het
Dennd4a C T 9: 64,911,755 (GRCm38) P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 (GRCm38) V892D possibly damaging Het
Fam131b A G 6: 42,321,248 (GRCm38) probably null Het
Fam83b T A 9: 76,491,850 (GRCm38) D657V possibly damaging Het
Fam83e T A 7: 45,722,363 (GRCm38) probably null Het
Fbxo4 A T 15: 3,977,819 (GRCm38) I121N probably damaging Het
Gm10471 T C 5: 26,084,718 (GRCm38) E237G probably damaging Het
Grid2 T A 6: 64,663,162 (GRCm38) I788N probably damaging Het
Grik4 T A 9: 42,688,023 (GRCm38) N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 (GRCm38) probably null Het
Hps5 T C 7: 46,789,196 (GRCm38) T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 (GRCm38) D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 (GRCm38) M985I probably damaging Het
Kdm5d A G Y: 900,525 (GRCm38) Y190C probably damaging Het
Krt86 T C 15: 101,476,610 (GRCm38) S295P probably damaging Het
Matr3 T A 18: 35,587,738 (GRCm38) D413E probably benign Het
Mbd5 T A 2: 49,274,645 (GRCm38) F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 (GRCm38) Y411N probably damaging Het
Mpdz C A 4: 81,285,474 (GRCm38) E1863* probably null Het
Mrps9 A G 1: 42,895,378 (GRCm38) E173G probably damaging Het
Olfr8 A T 10: 78,955,357 (GRCm38) I51F probably benign Het
Osmr T C 15: 6,821,047 (GRCm38) T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 (GRCm38) H3641L possibly damaging Het
Pml T C 9: 58,233,182 (GRCm38) T421A possibly damaging Het
Podxl A G 6: 31,528,456 (GRCm38) probably null Het
Ppargc1b C G 18: 61,309,093 (GRCm38) D591H probably damaging Het
Prkag3 A G 1: 74,748,816 (GRCm38) probably benign Het
Proz A G 8: 13,073,448 (GRCm38) R240G probably benign Het
Ptpn13 C A 5: 103,476,960 (GRCm38) D43E probably damaging Het
Rbm5 T G 9: 107,760,326 (GRCm38) K135N probably damaging Het
Ska1 G A 18: 74,197,528 (GRCm38) T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 (GRCm38) probably null Het
Slc9a3 T C 13: 74,161,723 (GRCm38) L510P probably damaging Het
Svil A G 18: 5,082,828 (GRCm38) K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 (GRCm38) S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 (GRCm38) D260V probably damaging Het
Ttc9 G T 12: 81,631,622 (GRCm38) R73L probably damaging Het
Vps13b A G 15: 35,917,061 (GRCm38) I3684V probably damaging Het
Vps8 T C 16: 21,461,439 (GRCm38) probably null Het
Vwa3b T A 1: 37,076,439 (GRCm38) I328N probably damaging Het
Wdr1 C T 5: 38,530,023 (GRCm38) V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 (GRCm38) T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 (GRCm38) S111F probably benign Het
Zfp768 G A 7: 127,344,546 (GRCm38) P137S probably benign Het
Other mutations in Gabrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Gabrg2 APN 11 41,971,772 (GRCm38) missense possibly damaging 0.87
IGL00787:Gabrg2 APN 11 41,912,522 (GRCm38) missense probably benign 0.00
IGL01941:Gabrg2 APN 11 41,971,721 (GRCm38) missense probably damaging 1.00
IGL02801:Gabrg2 APN 11 41,912,393 (GRCm38) missense probably damaging 1.00
R0376:Gabrg2 UTSW 11 41,916,315 (GRCm38) missense possibly damaging 0.92
R1607:Gabrg2 UTSW 11 41,976,663 (GRCm38) missense probably damaging 0.98
R1934:Gabrg2 UTSW 11 41,920,470 (GRCm38) missense probably benign 0.10
R2226:Gabrg2 UTSW 11 41,971,908 (GRCm38) missense probably damaging 1.00
R2281:Gabrg2 UTSW 11 41,976,636 (GRCm38) missense possibly damaging 0.72
R4013:Gabrg2 UTSW 11 41,971,880 (GRCm38) missense possibly damaging 0.83
R4675:Gabrg2 UTSW 11 41,968,823 (GRCm38) missense probably damaging 1.00
R4869:Gabrg2 UTSW 11 41,920,404 (GRCm38) missense probably damaging 1.00
R5282:Gabrg2 UTSW 11 41,971,732 (GRCm38) missense probably damaging 1.00
R5316:Gabrg2 UTSW 11 41,976,558 (GRCm38) missense probably damaging 1.00
R5729:Gabrg2 UTSW 11 41,967,623 (GRCm38) missense probably damaging 1.00
R6279:Gabrg2 UTSW 11 42,000,523 (GRCm38) splice site probably null
R6300:Gabrg2 UTSW 11 42,000,523 (GRCm38) splice site probably null
R6315:Gabrg2 UTSW 11 41,971,861 (GRCm38) missense probably damaging 0.99
R7181:Gabrg2 UTSW 11 41,920,434 (GRCm38) missense probably damaging 1.00
R7182:Gabrg2 UTSW 11 41,920,506 (GRCm38) missense probably damaging 0.98
R7368:Gabrg2 UTSW 11 41,976,563 (GRCm38) nonsense probably null
R7568:Gabrg2 UTSW 11 41,916,292 (GRCm38) missense probably benign 0.05
R7599:Gabrg2 UTSW 11 41,967,624 (GRCm38) missense possibly damaging 0.79
R7901:Gabrg2 UTSW 11 41,976,591 (GRCm38) missense probably benign 0.00
R7940:Gabrg2 UTSW 11 41,967,647 (GRCm38) missense probably benign 0.06
R8250:Gabrg2 UTSW 11 41,967,552 (GRCm38) missense probably benign 0.00
R8899:Gabrg2 UTSW 11 41,976,550 (GRCm38) nonsense probably null
R9043:Gabrg2 UTSW 11 41,974,835 (GRCm38) missense probably damaging 0.98
R9382:Gabrg2 UTSW 11 41,967,606 (GRCm38) missense probably benign 0.43
R9720:Gabrg2 UTSW 11 41,971,846 (GRCm38) missense probably damaging 1.00
X0065:Gabrg2 UTSW 11 41,912,369 (GRCm38) missense probably damaging 1.00
Z1191:Gabrg2 UTSW 11 41,916,277 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCAGTCTGGACACATTGTC -3'
(R):5'- ATGCTCGGAAATAATTCTTGCCTAG -3'

Sequencing Primer
(F):5'- AAGAGTTGCCCATTCTATCAATTC -3'
(R):5'- CGGAAATAATTCTTGCCTAGAACTTG -3'
Posted On 2017-02-10