Incidental Mutation 'R5876:Dcaf1'
ID490529
Institutional Source Beutler Lab
Gene Symbol Dcaf1
Ensembl Gene ENSMUSG00000040325
Gene NameDDB1 and CUL4 associated factor 1
SynonymsB930007L02Rik, Vprbp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5876 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106821874-106880992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106863650 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1279 (W1279R)
Ref Sequence ENSEMBL: ENSMUSP00000125730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]
Predicted Effect probably damaging
Transcript: ENSMUST00000055009
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: W1279R

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159645
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: W1279R

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161758
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: W1279R

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,663,582 D64G possibly damaging Het
Ano2 T A 6: 126,039,279 M925K possibly damaging Het
Arnt2 T C 7: 84,347,512 T69A probably damaging Het
Asap2 T A 12: 21,212,809 N229K possibly damaging Het
Atp13a3 T A 16: 30,362,734 N23Y probably benign Het
Cbr4 G A 8: 61,490,593 G91R possibly damaging Het
Cdc27 A T 11: 104,515,418 C624S probably benign Het
Cdc42bpg T A 19: 6,310,815 I201N probably damaging Het
Cdh5 A G 8: 104,142,577 Y645C probably damaging Het
Celsr2 C T 3: 108,413,943 V518I probably damaging Het
Clca4b T C 3: 144,912,060 T761A possibly damaging Het
Cpne4 C A 9: 104,925,770 S204R probably damaging Het
Dennd4a C T 9: 64,911,755 P1731S probably damaging Het
Dmxl1 T A 18: 49,870,984 V892D possibly damaging Het
Fam131b A G 6: 42,321,248 probably null Het
Fam83b T A 9: 76,491,850 D657V possibly damaging Het
Fam83e T A 7: 45,722,363 probably null Het
Fbxo4 A T 15: 3,977,819 I121N probably damaging Het
Gabrg2 A G 11: 41,968,820 S202P probably damaging Het
Gm10471 T C 5: 26,084,718 E237G probably damaging Het
Grid2 T A 6: 64,663,162 I788N probably damaging Het
Grik4 T A 9: 42,688,023 N53Y probably damaging Het
Hipk2 A C 6: 38,730,867 probably null Het
Hps5 T C 7: 46,789,196 T38A probably damaging Het
Hs1bp3 A G 12: 8,341,843 D315G possibly damaging Het
Kdm4a C T 4: 118,138,876 M985I probably damaging Het
Kdm5d A G Y: 900,525 Y190C probably damaging Het
Krt86 T C 15: 101,476,610 S295P probably damaging Het
Matr3 T A 18: 35,587,738 D413E probably benign Het
Mbd5 T A 2: 49,274,645 F319L probably damaging Het
Mcoln1 T A 8: 3,510,910 Y411N probably damaging Het
Mpdz C A 4: 81,285,474 E1863* probably null Het
Mrps9 A G 1: 42,895,378 E173G probably damaging Het
Olfr8 A T 10: 78,955,357 I51F probably benign Het
Osmr T C 15: 6,821,047 T692A probably benign Het
Pkhd1l1 A T 15: 44,578,588 H3641L possibly damaging Het
Pml T C 9: 58,233,182 T421A possibly damaging Het
Podxl A G 6: 31,528,456 probably null Het
Ppargc1b C G 18: 61,309,093 D591H probably damaging Het
Prkag3 A G 1: 74,748,816 probably benign Het
Proz A G 8: 13,073,448 R240G probably benign Het
Ptpn13 C A 5: 103,476,960 D43E probably damaging Het
Rbm5 T G 9: 107,760,326 K135N probably damaging Het
Ska1 G A 18: 74,197,528 T201M probably damaging Het
Slc35f5 A C 1: 125,587,363 probably null Het
Slc9a3 T C 13: 74,161,723 L510P probably damaging Het
Svil A G 18: 5,082,828 K1231E probably damaging Het
Tanc2 T C 11: 105,922,613 S1628P possibly damaging Het
Tm9sf3 T A 19: 41,240,584 D260V probably damaging Het
Ttc9 G T 12: 81,631,622 R73L probably damaging Het
Vps13b A G 15: 35,917,061 I3684V probably damaging Het
Vps8 T C 16: 21,461,439 probably null Het
Vwa3b T A 1: 37,076,439 I328N probably damaging Het
Wdr1 C T 5: 38,530,023 V222M probably benign Het
Xpnpep1 T A 19: 52,997,008 T530S probably damaging Het
Zc3h6 C T 2: 128,993,277 S111F probably benign Het
Zfp768 G A 7: 127,344,546 P137S probably benign Het
Other mutations in Dcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Dcaf1 APN 9 106858333 missense probably benign 0.45
IGL01314:Dcaf1 APN 9 106834191 missense probably benign 0.07
IGL01395:Dcaf1 APN 9 106858162 missense possibly damaging 0.73
IGL01936:Dcaf1 APN 9 106859601 missense possibly damaging 0.81
IGL02089:Dcaf1 APN 9 106863111 missense probably benign 0.40
IGL02596:Dcaf1 APN 9 106863021 missense probably damaging 1.00
IGL02828:Dcaf1 APN 9 106844302 splice site probably benign
IGL03036:Dcaf1 APN 9 106844140 missense probably damaging 1.00
IGL03327:Dcaf1 APN 9 106858624 missense possibly damaging 0.79
Latte UTSW 9 106846772 nonsense probably null
IGL02799:Dcaf1 UTSW 9 106857940 missense probably benign 0.42
P0023:Dcaf1 UTSW 9 106860451 missense probably benign 0.40
R0087:Dcaf1 UTSW 9 106863089 missense probably damaging 1.00
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0562:Dcaf1 UTSW 9 106844122 splice site probably benign
R0690:Dcaf1 UTSW 9 106846649 splice site probably benign
R1373:Dcaf1 UTSW 9 106857880 missense probably benign 0.18
R1508:Dcaf1 UTSW 9 106854177 missense probably damaging 1.00
R1765:Dcaf1 UTSW 9 106864594 missense probably damaging 1.00
R1845:Dcaf1 UTSW 9 106851962 missense probably benign 0.01
R2016:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106847923 missense probably damaging 0.99
R2246:Dcaf1 UTSW 9 106854177 missense possibly damaging 0.94
R2321:Dcaf1 UTSW 9 106838473 missense probably benign 0.04
R4528:Dcaf1 UTSW 9 106844204 missense probably damaging 1.00
R4646:Dcaf1 UTSW 9 106846807 missense probably benign 0.27
R4648:Dcaf1 UTSW 9 106865677 unclassified probably benign
R4742:Dcaf1 UTSW 9 106858555 missense probably benign 0.00
R5926:Dcaf1 UTSW 9 106838362 missense probably benign 0.02
R6057:Dcaf1 UTSW 9 106854247 missense probably damaging 0.99
R6335:Dcaf1 UTSW 9 106838646 missense possibly damaging 0.63
R6518:Dcaf1 UTSW 9 106835589 missense probably damaging 1.00
R6812:Dcaf1 UTSW 9 106858069 missense probably damaging 1.00
R6829:Dcaf1 UTSW 9 106838604 missense probably damaging 0.97
R6972:Dcaf1 UTSW 9 106846772 nonsense probably null
R7175:Dcaf1 UTSW 9 106858576 missense probably benign 0.32
R7650:Dcaf1 UTSW 9 106838344 missense probably benign 0.01
R7734:Dcaf1 UTSW 9 106838679 missense probably damaging 1.00
X0019:Dcaf1 UTSW 9 106834159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACAGCAATCAGTAATACATGTTGGC -3'
(R):5'- TCTAAGCTACCTGAGACCCTG -3'

Sequencing Primer
(F):5'- ATGCAGTGCAGAGTGCT -3'
(R):5'- GCCTTTTAGCCTAAATCAACAAAATG -3'
Posted On2017-10-20