Mutagenetix > Incidental Mutation

Incidental Mutation 'R5876:Dcaf1'

490529

Institutional Source

Beutler Lab

Gene Symbol

Dcaf1

Ensembl Gene

ENSMUSG00000040325

Gene Name

DDB1 and CUL4 associated factor 1

Synonyms

B930007L02Rik, Vprbp

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5876 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106821874-106880992 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106863650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1279 (W1279R)

Ref Sequence

ENSEMBL: ENSMUSP00000125730 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]

AlphaFold

Q80TR8

Predicted Effect

probably damaging
Transcript: ENSMUST00000055009
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: W1279R

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1392	N/A	PDB
SCOP:d1tbga_	1063	1375	9e-20	SMART
Blast:WD40	1078	1120	3e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1393	1452	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
PDB:4P7I\|D	1484	1506	2e-6	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000159620

SMART Domains

Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

Domain	Start	End	E-Value	Type
Pfam:Armet	18	120	1.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159645
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: W1279R

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1394	N/A	PDB
SCOP:d1tbga_	1063	1375	1e-19	SMART
Blast:WD40	1078	1120	2e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1395	1402	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161758
AA Change: W1279R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: W1279R

Domain	Start	End	E-Value	Type
low complexity region	175	191	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
LisH	845	877	1.77e-3	SMART
low complexity region	920	945	N/A	INTRINSIC
PDB:4PXW\|B	1038	1398	N/A	PDB
SCOP:d1tbga_	1063	1308	3e-19	SMART
Blast:WD40	1078	1120	3e-22	BLAST
Blast:WD40	1123	1164	7e-19	BLAST
low complexity region	1399	1458	N/A	INTRINSIC
low complexity region	1463	1489	N/A	INTRINSIC
PDB:4P7I\|D	1490	1512	2e-6	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,663,582	D64G	possibly damaging	Het
Ano2	T	A	6: 126,039,279	M925K	possibly damaging	Het
Arnt2	T	C	7: 84,347,512	T69A	probably damaging	Het
Asap2	T	A	12: 21,212,809	N229K	possibly damaging	Het
Atp13a3	T	A	16: 30,362,734	N23Y	probably benign	Het
Cbr4	G	A	8: 61,490,593	G91R	possibly damaging	Het
Cdc27	A	T	11: 104,515,418	C624S	probably benign	Het
Cdc42bpg	T	A	19: 6,310,815	I201N	probably damaging	Het
Cdh5	A	G	8: 104,142,577	Y645C	probably damaging	Het
Celsr2	C	T	3: 108,413,943	V518I	probably damaging	Het
Clca4b	T	C	3: 144,912,060	T761A	possibly damaging	Het
Cpne4	C	A	9: 104,925,770	S204R	probably damaging	Het
Dennd4a	C	T	9: 64,911,755	P1731S	probably damaging	Het
Dmxl1	T	A	18: 49,870,984	V892D	possibly damaging	Het
Fam131b	A	G	6: 42,321,248		probably null	Het
Fam83b	T	A	9: 76,491,850	D657V	possibly damaging	Het
Fam83e	T	A	7: 45,722,363		probably null	Het
Fbxo4	A	T	15: 3,977,819	I121N	probably damaging	Het
Gabrg2	A	G	11: 41,968,820	S202P	probably damaging	Het
Gm10471	T	C	5: 26,084,718	E237G	probably damaging	Het
Grid2	T	A	6: 64,663,162	I788N	probably damaging	Het
Grik4	T	A	9: 42,688,023	N53Y	probably damaging	Het
Hipk2	A	C	6: 38,730,867		probably null	Het
Hps5	T	C	7: 46,789,196	T38A	probably damaging	Het
Hs1bp3	A	G	12: 8,341,843	D315G	possibly damaging	Het
Kdm4a	C	T	4: 118,138,876	M985I	probably damaging	Het
Kdm5d	A	G	Y: 900,525	Y190C	probably damaging	Het
Krt86	T	C	15: 101,476,610	S295P	probably damaging	Het
Matr3	T	A	18: 35,587,738	D413E	probably benign	Het
Mbd5	T	A	2: 49,274,645	F319L	probably damaging	Het
Mcoln1	T	A	8: 3,510,910	Y411N	probably damaging	Het
Mpdz	C	A	4: 81,285,474	E1863*	probably null	Het
Mrps9	A	G	1: 42,895,378	E173G	probably damaging	Het
Olfr8	A	T	10: 78,955,357	I51F	probably benign	Het
Osmr	T	C	15: 6,821,047	T692A	probably benign	Het
Pkhd1l1	A	T	15: 44,578,588	H3641L	possibly damaging	Het
Pml	T	C	9: 58,233,182	T421A	possibly damaging	Het
Podxl	A	G	6: 31,528,456		probably null	Het
Ppargc1b	C	G	18: 61,309,093	D591H	probably damaging	Het
Prkag3	A	G	1: 74,748,816		probably benign	Het
Proz	A	G	8: 13,073,448	R240G	probably benign	Het
Ptpn13	C	A	5: 103,476,960	D43E	probably damaging	Het
Rbm5	T	G	9: 107,760,326	K135N	probably damaging	Het
Ska1	G	A	18: 74,197,528	T201M	probably damaging	Het
Slc35f5	A	C	1: 125,587,363		probably null	Het
Slc9a3	T	C	13: 74,161,723	L510P	probably damaging	Het
Svil	A	G	18: 5,082,828	K1231E	probably damaging	Het
Tanc2	T	C	11: 105,922,613	S1628P	possibly damaging	Het
Tm9sf3	T	A	19: 41,240,584	D260V	probably damaging	Het
Ttc9	G	T	12: 81,631,622	R73L	probably damaging	Het
Vps13b	A	G	15: 35,917,061	I3684V	probably damaging	Het
Vps8	T	C	16: 21,461,439		probably null	Het
Vwa3b	T	A	1: 37,076,439	I328N	probably damaging	Het
Wdr1	C	T	5: 38,530,023	V222M	probably benign	Het
Xpnpep1	T	A	19: 52,997,008	T530S	probably damaging	Het
Zc3h6	C	T	2: 128,993,277	S111F	probably benign	Het
Zfp768	G	A	7: 127,344,546	P137S	probably benign	Het

Other mutations in Dcaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Dcaf1	APN	9	106858333	missense	probably benign	0.45
IGL01314:Dcaf1	APN	9	106834191	missense	probably benign	0.07
IGL01395:Dcaf1	APN	9	106858162	missense	possibly damaging	0.73
IGL01936:Dcaf1	APN	9	106859601	missense	possibly damaging	0.81
IGL02089:Dcaf1	APN	9	106863111	missense	probably benign	0.40
IGL02596:Dcaf1	APN	9	106863021	missense	probably damaging	1.00
IGL02828:Dcaf1	APN	9	106844302	splice site	probably benign
IGL03036:Dcaf1	APN	9	106844140	missense	probably damaging	1.00
IGL03327:Dcaf1	APN	9	106858624	missense	possibly damaging	0.79
Americano	UTSW	9	106879959	nonsense	probably null
Latte	UTSW	9	106846772	nonsense	probably null
IGL02799:Dcaf1	UTSW	9	106857940	missense	probably benign	0.42
P0023:Dcaf1	UTSW	9	106860451	missense	probably benign	0.40
R0087:Dcaf1	UTSW	9	106863089	missense	probably damaging	1.00
R0164:Dcaf1	UTSW	9	106844145	missense	possibly damaging	0.94
R0164:Dcaf1	UTSW	9	106844145	missense	possibly damaging	0.94
R0562:Dcaf1	UTSW	9	106844122	splice site	probably benign
R0690:Dcaf1	UTSW	9	106846649	splice site	probably benign
R1373:Dcaf1	UTSW	9	106857880	missense	probably benign	0.18
R1508:Dcaf1	UTSW	9	106854177	missense	probably damaging	1.00
R1765:Dcaf1	UTSW	9	106864594	missense	probably damaging	1.00
R1845:Dcaf1	UTSW	9	106851962	missense	probably benign	0.01
R2016:Dcaf1	UTSW	9	106839088	missense	probably benign	0.41
R2017:Dcaf1	UTSW	9	106839088	missense	probably benign	0.41
R2017:Dcaf1	UTSW	9	106847923	missense	probably damaging	0.99
R2246:Dcaf1	UTSW	9	106854177	missense	possibly damaging	0.94
R2321:Dcaf1	UTSW	9	106838473	missense	probably benign	0.04
R4528:Dcaf1	UTSW	9	106844204	missense	probably damaging	1.00
R4646:Dcaf1	UTSW	9	106846807	missense	probably benign	0.27
R4648:Dcaf1	UTSW	9	106865677	unclassified	probably benign
R4742:Dcaf1	UTSW	9	106858555	missense	probably benign	0.00
R5926:Dcaf1	UTSW	9	106838362	missense	probably benign	0.02
R6057:Dcaf1	UTSW	9	106854247	missense	probably damaging	0.99
R6335:Dcaf1	UTSW	9	106838646	missense	possibly damaging	0.63
R6518:Dcaf1	UTSW	9	106835589	missense	probably damaging	1.00
R6812:Dcaf1	UTSW	9	106858069	missense	probably damaging	1.00
R6829:Dcaf1	UTSW	9	106838604	missense	probably damaging	0.97
R6972:Dcaf1	UTSW	9	106846772	nonsense	probably null
R7175:Dcaf1	UTSW	9	106858576	missense	probably benign	0.32
R7650:Dcaf1	UTSW	9	106838344	missense	probably benign	0.01
R7734:Dcaf1	UTSW	9	106838679	missense	probably damaging	1.00
R8179:Dcaf1	UTSW	9	106857916	missense	probably damaging	1.00
R8230:Dcaf1	UTSW	9	106858715	missense	probably damaging	0.99
R8247:Dcaf1	UTSW	9	106854228	missense	possibly damaging	0.51
R8440:Dcaf1	UTSW	9	106847874	missense	possibly damaging	0.94
R8543:Dcaf1	UTSW	9	106858078	missense	probably benign	0.06
R8674:Dcaf1	UTSW	9	106863697	missense	probably damaging	1.00
R8728:Dcaf1	UTSW	9	106846806	missense	possibly damaging	0.92
R8807:Dcaf1	UTSW	9	106865069	missense	probably benign	0.05
R8883:Dcaf1	UTSW	9	106847640	intron	probably benign
R8953:Dcaf1	UTSW	9	106858343	missense	possibly damaging	0.66
R9018:Dcaf1	UTSW	9	106865637	missense	probably damaging	1.00
R9113:Dcaf1	UTSW	9	106835632	splice site	probably benign
R9300:Dcaf1	UTSW	9	106847843	missense	possibly damaging	0.92
R9414:Dcaf1	UTSW	9	106879959	nonsense	probably null
R9428:Dcaf1	UTSW	9	106858329	missense	possibly damaging	0.52
R9486:Dcaf1	UTSW	9	106858717	missense	possibly damaging	0.88
R9685:Dcaf1	UTSW	9	106836619	missense	probably benign	0.01
R9700:Dcaf1	UTSW	9	106858325	missense	probably benign	0.01
R9760:Dcaf1	UTSW	9	106874267	missense	unknown
X0019:Dcaf1	UTSW	9	106834159	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- ACAGCAATCAGTAATACATGTTGGC -3'
(R):5'- TCTAAGCTACCTGAGACCCTG -3'

Sequencing Primer
(F):5'- ATGCAGTGCAGAGTGCT -3'
(R):5'- GCCTTTTAGCCTAAATCAACAAAATG -3'

Posted On

2017-10-20