Incidental Mutation 'R6145:Zfp346'
ID488835
Institutional Source Beutler Lab
Gene Symbol Zfp346
Ensembl Gene ENSMUSG00000021481
Gene Namezinc finger protein 346
Synonyms
MMRRC Submission 044292-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6145 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55105311-55134825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55115574 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 156 (K156R)
Ref Sequence ENSEMBL: ENSMUSP00000021937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021937] [ENSMUST00000159147] [ENSMUST00000159278] [ENSMUST00000160660] [ENSMUST00000161315] [ENSMUST00000161551] [ENSMUST00000162428] [ENSMUST00000162476]
Predicted Effect probably damaging
Transcript: ENSMUST00000021937
AA Change: K156R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021937
Gene: ENSMUSG00000021481
AA Change: K156R

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 182 216 1.87e-8 SMART
ZnF_C2H2 185 209 1.51e1 SMART
ZnF_U1 236 270 1.99e-3 SMART
ZnF_C2H2 239 263 3.47e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159147
AA Change: K124R

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124107
Gene: ENSMUSG00000021481
AA Change: K124R

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:zf-met 73 96 3.3e-5 PFAM
ZnF_U1 99 133 5.22e-7 SMART
ZnF_C2H2 102 126 4.98e-1 SMART
ZnF_U1 150 184 1.87e-8 SMART
ZnF_C2H2 153 177 1.51e1 SMART
ZnF_U1 204 238 1.99e-3 SMART
ZnF_C2H2 207 231 3.47e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159278
AA Change: K156R

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125078
Gene: ENSMUSG00000021481
AA Change: K156R

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
ZnF_U1 131 165 5.22e-7 SMART
ZnF_C2H2 134 158 4.98e-1 SMART
ZnF_U1 198 232 1.87e-8 SMART
ZnF_C2H2 201 225 1.51e1 SMART
ZnF_U1 251 285 1.99e-3 SMART
ZnF_C2H2 254 278 3.47e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160660
SMART Domains Protein: ENSMUSP00000124034
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161018
SMART Domains Protein: ENSMUSP00000125154
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161077
AA Change: K137R
SMART Domains Protein: ENSMUSP00000125204
Gene: ENSMUSG00000021481
AA Change: K137R

DomainStartEndE-ValueType
ZnF_U1 52 86 1.26e-5 SMART
ZnF_C2H2 55 79 2.61e1 SMART
ZnF_U1 113 147 5.22e-7 SMART
ZnF_C2H2 116 140 4.98e-1 SMART
ZnF_U1 180 214 1.87e-8 SMART
ZnF_C2H2 183 207 1.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161315
SMART Domains Protein: ENSMUSP00000124397
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161551
SMART Domains Protein: ENSMUSP00000124180
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
PDB:1ZU1|A 53 93 4e-12 PDB
Blast:ZnF_U1 70 94 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162288
Predicted Effect probably benign
Transcript: ENSMUST00000162428
SMART Domains Protein: ENSMUSP00000125389
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162476
SMART Domains Protein: ENSMUSP00000125743
Gene: ENSMUSG00000021481

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
ZnF_U1 70 104 1.26e-5 SMART
ZnF_C2H2 73 97 2.61e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. It plays a role in protecting neurons by inhibiting cell cycle re-entry via stimulation of p21 gene expression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik T A 1: 86,052,942 probably null Het
4930402H24Rik T C 2: 130,778,473 I247V probably benign Het
Abca8b A G 11: 109,973,808 V316A probably benign Het
Acad10 A T 5: 121,622,033 V999D probably damaging Het
Acot8 A G 2: 164,803,065 V66A probably benign Het
Ankrd11 T C 8: 122,892,661 H1484R probably damaging Het
Anxa6 A G 11: 54,994,904 F405S probably damaging Het
Asmt G A X: 170,674,663 V101I probably damaging Het
Atp1a2 C T 1: 172,287,238 V327I probably damaging Het
Brdt A G 5: 107,377,999 E906G possibly damaging Het
Cacna1g A T 11: 94,462,261 C313S probably damaging Het
Camk2d T C 3: 126,805,858 I329T probably benign Het
Cavin4 A T 4: 48,663,794 H58L probably damaging Het
Ccdc78 C A 17: 25,789,065 P317T probably benign Het
Cdc16 T G 8: 13,767,573 Y295D possibly damaging Het
Cdyl2 T A 8: 116,594,978 N270I probably damaging Het
Cfap221 T A 1: 119,984,816 I114F possibly damaging Het
Dmxl1 A G 18: 49,912,766 E2414G possibly damaging Het
Dnah1 C A 14: 31,300,970 R1070L probably benign Het
Dnah14 T C 1: 181,666,417 S1713P probably benign Het
Dock10 C A 1: 80,575,904 G602* probably null Het
Ep400 A T 5: 110,756,703 V10D possibly damaging Het
Epas1 T C 17: 86,829,429 C807R probably benign Het
Esrrb C T 12: 86,505,899 P200L probably benign Het
Fbxw26 T C 9: 109,732,623 I168V probably benign Het
Fsip2 A T 2: 82,993,768 H6615L possibly damaging Het
Galk2 A T 2: 125,946,842 Q272L possibly damaging Het
Gas7 A C 11: 67,629,612 T43P probably damaging Het
Gm5134 A T 10: 75,995,839 I371F probably damaging Het
Gpr31b C T 17: 13,051,379 R301Q possibly damaging Het
Grk1 T A 8: 13,405,765 Y216* probably null Het
Grm5 T A 7: 88,026,601 M441K probably damaging Het
Heatr6 A G 11: 83,766,136 E408G probably damaging Het
Hoxc9 G T 15: 102,983,959 K201N probably damaging Het
Igsf10 T A 3: 59,331,656 Y368F possibly damaging Het
Il2ra A T 2: 11,680,246 D131V probably damaging Het
Imp4 A G 1: 34,440,096 E19G probably benign Het
Kcnk18 T C 19: 59,235,607 *395Q probably null Het
Kdm6b A T 11: 69,405,026 L805Q unknown Het
Lgr4 T A 2: 110,007,243 L427* probably null Het
Myt1l G A 12: 29,832,381 S525N unknown Het
Nasp G A 4: 116,611,077 T237I probably benign Het
Nell2 G T 15: 95,473,561 Q98K probably damaging Het
Nfasc C T 1: 132,634,717 G107R probably damaging Het
Nsun4 A G 4: 116,040,206 S203P probably damaging Het
Olfr24 T G 9: 18,755,569 D22A probably benign Het
Olfr855 T C 9: 19,584,888 V117A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pde10a T C 17: 8,929,117 V366A probably damaging Het
Pdxk T A 10: 78,443,791 D250V probably benign Het
Pih1d1 T A 7: 45,159,044 I179N probably damaging Het
Plaa T A 4: 94,583,992 I294F probably damaging Het
Pmel C A 10: 128,715,935 P213T probably damaging Het
Pom121l2 A T 13: 21,982,302 R248* probably null Het
Pou2f1 T C 1: 165,875,433 probably benign Het
Ppm1j G A 3: 104,781,379 R98H probably damaging Het
Prkdc C T 16: 15,772,073 P2600L probably damaging Het
Prom1 T C 5: 44,029,649 N422S probably benign Het
Pspn C T 17: 56,999,467 C154Y probably damaging Het
Ptdss1 T C 13: 66,972,637 probably null Het
Rapgef1 A G 2: 29,736,666 Y993C probably damaging Het
Scrn2 A C 11: 97,032,853 T219P probably benign Het
Sec23ip T G 7: 128,778,484 S874R probably damaging Het
Sept4 G A 11: 87,585,246 probably null Het
Slc15a3 C T 19: 10,857,251 L499F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sra1 A G 18: 36,667,575 M193T probably damaging Het
Srsf4 G T 4: 131,900,294 probably benign Het
Syne1 T C 10: 5,052,750 D8055G probably damaging Het
Syne4 T A 7: 30,316,563 probably null Het
Tbc1d24 C A 17: 24,208,229 G253V probably damaging Het
Tbck T A 3: 132,732,215 I467N probably damaging Het
Tln1 T A 4: 43,538,030 M1857L possibly damaging Het
Ttll2 T C 17: 7,351,632 R299G probably benign Het
Ugt2b36 T G 5: 87,066,213 E524A probably benign Het
Vmn2r124 C T 17: 18,062,851 T269I probably benign Het
Vmn2r4 A G 3: 64,406,943 F206L probably benign Het
Other mutations in Zfp346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Zfp346 UTSW 13 55113097 nonsense probably null
R2025:Zfp346 UTSW 13 55132308 missense probably damaging 1.00
R2879:Zfp346 UTSW 13 55105350 missense possibly damaging 0.66
R4564:Zfp346 UTSW 13 55113707 missense probably damaging 1.00
R4821:Zfp346 UTSW 13 55113813 intron probably benign
R5647:Zfp346 UTSW 13 55122357 missense probably damaging 1.00
R5665:Zfp346 UTSW 13 55113102 missense probably benign 0.39
R6450:Zfp346 UTSW 13 55113704 missense probably damaging 1.00
R7034:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7036:Zfp346 UTSW 13 55132387 missense probably benign 0.28
R7148:Zfp346 UTSW 13 55105450 missense possibly damaging 0.78
R7298:Zfp346 UTSW 13 55130603 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGTCTTAAATGTCCACCAGC -3'
(R):5'- TGAGCATTCTGGAAGCACC -3'

Sequencing Primer
(F):5'- GGTCTTAAATGTCCACCAGCCAATG -3'
(R):5'- CAATGGTGCCCTGAGGATG -3'
Posted On2017-10-10