Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Mthfr'

489860

Institutional Source

Beutler Lab

Gene Symbol

Mthfr

Ensembl Gene

ENSMUSG00000029009

Gene Name

methylenetetrahydrofolate reductase

Synonyms

MMRRC Submission

044308-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.790) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

148039077-148059551 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 148041754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 94 (D94G)

Ref Sequence

ENSEMBL: ENSMUSP00000069774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000069604] [ENSMUST00000097788] [ENSMUST00000105711] [ENSMUST00000131232] [ENSMUST00000137724] [ENSMUST00000141283] [ENSMUST00000152498]

AlphaFold

Q9WU20

Predicted Effect

probably benign
Transcript: ENSMUST00000030879

SMART Domains

Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	138	571	5.5e-98	PFAM
CBS	609	658	1.68e-3	SMART
CBS	811	859	1.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000069604
AA Change: D94G

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000069774
Gene: ENSMUSG00000029009
AA Change: D94G

Domain	Start	End	E-Value	Type
low complexity region	48	73	N/A	INTRINSIC
Pfam:MTHFR	88	377	2.3e-121	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097788
AA Change: D53G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000095395
Gene: ENSMUSG00000029009
AA Change: D53G

Domain	Start	End	E-Value	Type
low complexity region	7	32	N/A	INTRINSIC
Pfam:MTHFR	47	336	5.9e-121	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105711

SMART Domains

Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.5e-98	PFAM
CBS	612	661	1.68e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125978

Predicted Effect

probably benign
Transcript: ENSMUST00000131232

SMART Domains

Protein: ENSMUSP00000116153
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
transmembrane domain	27	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134377

Predicted Effect

probably benign
Transcript: ENSMUST00000137724

SMART Domains

Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:Voltage_CLC	141	574	1.9e-101	PFAM
CBS	612	661	1.68e-3	SMART
CBS	814	862	1.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141283
AA Change: D53G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116239
Gene: ENSMUSG00000029009
AA Change: D53G

Domain	Start	End	E-Value	Type
low complexity region	7	32	N/A	INTRINSIC
Pfam:MTHFR	47	194	7.4e-57	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145115

Predicted Effect

probably benign
Transcript: ENSMUST00000152498
AA Change: D69G

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000117095
Gene: ENSMUSG00000029009
AA Change: D69G

Domain	Start	End	E-Value	Type
low complexity region	23	48	N/A	INTRINSIC
Pfam:MTHFR	63	352	2.4e-121	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have elevated plasma levels of homocysteine. They also display delayed growth and development and a reduced survival rate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Mthfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Mthfr	APN	4	148041270	missense	probably benign
IGL00911:Mthfr	APN	4	148041302	missense	probably benign	0.01
R0116:Mthfr	UTSW	4	148051523	missense	probably benign	0.00
R0207:Mthfr	UTSW	4	148052224	missense	probably damaging	1.00
R0268:Mthfr	UTSW	4	148055428	missense	probably damaging	1.00
R0344:Mthfr	UTSW	4	148055428	missense	probably damaging	1.00
R0762:Mthfr	UTSW	4	148055443	missense	possibly damaging	0.65
R1433:Mthfr	UTSW	4	148055443	missense	possibly damaging	0.92
R1464:Mthfr	UTSW	4	148053572	splice site	probably benign
R1972:Mthfr	UTSW	4	148051927	missense	probably damaging	1.00
R3154:Mthfr	UTSW	4	148051604	missense	probably benign	0.12
R3407:Mthfr	UTSW	4	148055061	missense	probably damaging	1.00
R3773:Mthfr	UTSW	4	148044450	missense	probably benign	0.00
R4153:Mthfr	UTSW	4	148051475	missense	probably damaging	0.99
R4291:Mthfr	UTSW	4	148055492	missense	probably damaging	1.00
R4487:Mthfr	UTSW	4	148051427	missense	probably benign	0.00
R4574:Mthfr	UTSW	4	148043541	missense	possibly damaging	0.95
R4583:Mthfr	UTSW	4	148051872	missense	possibly damaging	0.80
R4847:Mthfr	UTSW	4	148048139	missense	probably damaging	0.99
R5183:Mthfr	UTSW	4	148051360	splice site	probably null
R5536:Mthfr	UTSW	4	148044483	missense	probably damaging	1.00
R5664:Mthfr	UTSW	4	148055466	missense	probably damaging	1.00
R7285:Mthfr	UTSW	4	148053599	missense	probably benign	0.01
R7427:Mthfr	UTSW	4	148051603	missense	probably benign	0.00
R7428:Mthfr	UTSW	4	148051603	missense	probably benign	0.00
R7474:Mthfr	UTSW	4	148052602	missense	possibly damaging	0.95
R7823:Mthfr	UTSW	4	148051487	missense	probably benign	0.29
R7826:Mthfr	UTSW	4	148055010	missense	probably benign	0.00
R7975:Mthfr	UTSW	4	148043463	missense	probably damaging	1.00
R8669:Mthfr	UTSW	4	148051477	missense	probably benign	0.21
R8698:Mthfr	UTSW	4	148044490	nonsense	probably null
R8714:Mthfr	UTSW	4	148041818	missense	probably damaging	1.00
R8790:Mthfr	UTSW	4	148055534	missense	probably benign	0.07
R8961:Mthfr	UTSW	4	148043642	missense	probably damaging	1.00
R8981:Mthfr	UTSW	4	148054994	missense	probably benign	0.00
R9098:Mthfr	UTSW	4	148041625	missense	probably benign	0.10
R9221:Mthfr	UTSW	4	148048169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCAGGAATCCAGCCATG -3'
(R):5'- CTTCAGAGGGACTTTCACAGAC -3'

Sequencing Primer
(F):5'- CCAGCCATGGTGAACGAG -3'
(R):5'- GTCACAGACTAAACTCCCTGTCTCG -3'

Posted On

2017-10-10