Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Slc24a1'

489875

Institutional Source

Beutler Lab

Gene Symbol

Slc24a1

Ensembl Gene

ENSMUSG00000034452

Gene Name

solute carrier family 24 (sodium/potassium/calcium exchanger), member 1

Synonyms

MMRRC Submission

044308-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64922861-64951607 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64937263 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 606 (N606S)

Ref Sequence

ENSEMBL: ENSMUSP00000035616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037798]

Predicted Effect

unknown
Transcript: ENSMUST00000037798
AA Change: N606S

SMART Domains

Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: N606S

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Na_Ca_ex	425	569	1.7e-28	PFAM
low complexity region	683	699	N/A	INTRINSIC
coiled coil region	747	776	N/A	INTRINSIC
coiled coil region	818	847	N/A	INTRINSIC
coiled coil region	898	928	N/A	INTRINSIC
transmembrane domain	939	956	N/A	INTRINSIC
Pfam:Na_Ca_ex	967	1118	1.7e-33	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Chuk	T	C	19: 44,082,637	E543G	probably damaging	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Slc24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Slc24a1	APN	9	64928019	missense	probably damaging	0.99
IGL01602:Slc24a1	APN	9	64926181	missense	probably damaging	1.00
IGL03111:Slc24a1	APN	9	64926326	missense	probably damaging	0.98
R0092:Slc24a1	UTSW	9	64948752	missense	unknown
R0708:Slc24a1	UTSW	9	64947890	missense	unknown
R0827:Slc24a1	UTSW	9	64928190	missense	probably benign	0.03
R1294:Slc24a1	UTSW	9	64936013	missense	unknown
R1613:Slc24a1	UTSW	9	64948696	missense	unknown
R2858:Slc24a1	UTSW	9	64949332	missense	unknown
R3779:Slc24a1	UTSW	9	64948297	missense	unknown
R3899:Slc24a1	UTSW	9	64928144	missense	probably damaging	0.99
R3900:Slc24a1	UTSW	9	64928144	missense	probably damaging	0.99
R4409:Slc24a1	UTSW	9	64948224	missense	probably benign	0.39
R4732:Slc24a1	UTSW	9	64949554	missense	probably benign	0.23
R4733:Slc24a1	UTSW	9	64949554	missense	probably benign	0.23
R4745:Slc24a1	UTSW	9	64949476	missense	unknown
R4915:Slc24a1	UTSW	9	64947931	missense	unknown
R5371:Slc24a1	UTSW	9	64949268	missense	unknown
R5448:Slc24a1	UTSW	9	64948327	missense	probably benign	0.39
R5540:Slc24a1	UTSW	9	64948581	missense	unknown
R5863:Slc24a1	UTSW	9	64928542	missense	unknown
R6810:Slc24a1	UTSW	9	64948323	missense	probably benign	0.39
R7215:Slc24a1	UTSW	9	64928503	missense	unknown
R7380:Slc24a1	UTSW	9	64948533	missense	unknown
R7453:Slc24a1	UTSW	9	64949301	missense	unknown
R7466:Slc24a1	UTSW	9	64928404	missense	unknown
R7488:Slc24a1	UTSW	9	64924482	missense	probably benign	0.41
R7672:Slc24a1	UTSW	9	64947927	missense	unknown
X0063:Slc24a1	UTSW	9	64949143	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCATGTTTCCCAGGAGCCTC -3'
(R):5'- AGACAGGTGACACATTTGAGAC -3'

Sequencing Primer
(F):5'- TTCCCAGGAGCCTCCCAGG -3'
(R):5'- CACATTTGAGACAAAAGGTGGTG -3'

Posted On

2017-10-10