Incidental Mutation 'R6161:Slc24a1'
ID489875
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
MMRRC Submission 044308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6161 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64922861-64951607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64937263 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 606 (N606S)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
Predicted Effect unknown
Transcript: ENSMUST00000037798
AA Change: N606S
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: N606S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,540,711 K1533M probably damaging Het
Aldh1l2 C T 10: 83,520,338 V63I probably benign Het
Atr A G 9: 95,865,319 H218R probably benign Het
Atxn7l1 T A 12: 33,358,663 S275T possibly damaging Het
Cacna1c T C 6: 119,057,302 K88R probably damaging Het
Ccl7 T C 11: 82,046,586 Y49H probably damaging Het
Cd3eap G A 7: 19,357,633 T183I possibly damaging Het
Cers5 A G 15: 99,738,663 probably null Het
Chuk T C 19: 44,082,637 E543G probably damaging Het
Dip2c T C 13: 9,647,007 V1318A probably damaging Het
Ercc5 A G 1: 44,167,352 H475R probably benign Het
Fat3 A G 9: 16,377,522 L235P probably damaging Het
Fbn1 A T 2: 125,369,801 C892* probably null Het
Fbxw8 T C 5: 118,092,675 T354A possibly damaging Het
Fsip2 A C 2: 82,987,257 T4445P possibly damaging Het
Gpld1 A T 13: 24,971,414 Q344L probably benign Het
Hao1 A T 2: 134,505,625 D253E probably benign Het
Hmcn2 A G 2: 31,356,254 D745G probably benign Het
Kcnt1 A G 2: 25,903,385 T658A probably benign Het
Klhl35 A G 7: 99,473,337 probably benign Het
Lnx2 C T 5: 147,042,026 probably null Het
Map3k5 T C 10: 20,000,575 V160A probably damaging Het
Masp2 A T 4: 148,614,012 I517F possibly damaging Het
Mc4r A T 18: 66,859,180 Y287* probably null Het
Mthfr A G 4: 148,041,754 D94G probably benign Het
Muc16 A G 9: 18,647,818 I2393T unknown Het
Mybbp1a G T 11: 72,446,012 V557L probably damaging Het
Mycbp2 A T 14: 103,298,747 W256R probably damaging Het
Nacad G A 11: 6,600,902 S763L probably benign Het
Nebl A G 2: 17,730,830 V11A probably benign Het
Notch1 A T 2: 26,468,731 C1363S probably damaging Het
Nphp3 A G 9: 104,031,906 N772D probably benign Het
Nqo2 G A 13: 33,979,651 V98M probably damaging Het
Pak4 A G 7: 28,565,267 I70T possibly damaging Het
Pbx2 A G 17: 34,593,600 K2E probably damaging Het
Pikfyve A G 1: 65,216,043 T352A probably benign Het
Pop1 T C 15: 34,526,310 Y684H probably damaging Het
Rpa1 A G 11: 75,314,895 V212A probably damaging Het
Rpap2 A G 5: 107,620,670 E458G probably damaging Het
Sin3a T C 9: 57,095,424 V200A possibly damaging Het
Sla T C 15: 66,782,598 T280A probably null Het
Slc22a26 A T 19: 7,786,447 I406K possibly damaging Het
Slc39a10 G A 1: 46,827,407 T443M probably damaging Het
Smg1 A T 7: 118,163,330 probably benign Het
Sra1 G A 18: 36,670,283 A9V probably damaging Het
Stard4 A G 18: 33,209,056 V47A probably damaging Het
Stat4 A T 1: 52,074,677 D182V possibly damaging Het
Syt1 A G 10: 108,631,807 F210L probably damaging Het
Ube2q1 T A 3: 89,781,360 probably null Het
Vmn1r159 C T 7: 22,843,187 C140Y possibly damaging Het
Wnt8a T C 18: 34,545,546 F138L possibly damaging Het
Zfp623 T A 15: 75,948,621 D475E probably benign Het
Zfp646 C T 7: 127,878,725 R25W probably damaging Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64928019 missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64926181 missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64926326 missense probably damaging 0.98
R0092:Slc24a1 UTSW 9 64948752 missense unknown
R0708:Slc24a1 UTSW 9 64947890 missense unknown
R0827:Slc24a1 UTSW 9 64928190 missense probably benign 0.03
R1294:Slc24a1 UTSW 9 64936013 missense unknown
R1613:Slc24a1 UTSW 9 64948696 missense unknown
R2858:Slc24a1 UTSW 9 64949332 missense unknown
R3779:Slc24a1 UTSW 9 64948297 missense unknown
R3899:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64948224 missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64949476 missense unknown
R4915:Slc24a1 UTSW 9 64947931 missense unknown
R5371:Slc24a1 UTSW 9 64949268 missense unknown
R5448:Slc24a1 UTSW 9 64948327 missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64948581 missense unknown
R5863:Slc24a1 UTSW 9 64928542 missense unknown
R6810:Slc24a1 UTSW 9 64948323 missense probably benign 0.39
R7215:Slc24a1 UTSW 9 64928503 missense unknown
R7380:Slc24a1 UTSW 9 64948533 missense unknown
R7453:Slc24a1 UTSW 9 64949301 missense unknown
R7466:Slc24a1 UTSW 9 64928404 missense unknown
R7488:Slc24a1 UTSW 9 64924482 missense probably benign 0.41
R7672:Slc24a1 UTSW 9 64947927 missense unknown
X0063:Slc24a1 UTSW 9 64949143 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATGTTTCCCAGGAGCCTC -3'
(R):5'- AGACAGGTGACACATTTGAGAC -3'

Sequencing Primer
(F):5'- TTCCCAGGAGCCTCCCAGG -3'
(R):5'- CACATTTGAGACAAAAGGTGGTG -3'
Posted On2017-10-10