Mutagenetix > Incidental Mutations

Incidental Mutation 'R6284:Peak1'

508116

Institutional Source

Beutler Lab

Gene Symbol

Peak1

Ensembl Gene

ENSMUSG00000074305

Gene Name

pseudopodium-enriched atypical kinase 1

Synonyms

C230081A13Rik, NKF3 kinase family member, 1110049L02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R6284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56201126-56418067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56260296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 116 (L116P)

Ref Sequence

ENSEMBL: ENSMUSP00000109901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]

AlphaFold

Q69Z38

Predicted Effect

probably benign
Transcript: ENSMUST00000061552
AA Change: L116P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: L116P

Domain	Start	End	E-Value	Type
low complexity region	247	259	N/A	INTRINSIC
low complexity region	325	336	N/A	INTRINSIC
low complexity region	367	378	N/A	INTRINSIC
low complexity region	498	509	N/A	INTRINSIC
low complexity region	845	856	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	932	948	N/A	INTRINSIC
Pfam:Pkinase_Tyr	1437	1649	1.5e-6	PFAM
Pfam:Pkinase	1440	1651	2.3e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181444

Predicted Effect

probably benign
Transcript: ENSMUST00000186735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192330

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610030E20Rik	G	T	6: 72,347,454	G16C	probably damaging	Het
Abca7	G	A	10: 80,004,410	V801I	probably benign	Het
Adgrl2	A	T	3: 148,826,507	L1030Q	probably damaging	Het
Akap1	T	C	11: 88,844,568	T423A	possibly damaging	Het
Anpep	T	A	7: 79,825,802	D111V	probably damaging	Het
Atm	T	A	9: 53,445,376		probably null	Het
Atp5a1	T	A	18: 77,778,468	S106T	probably benign	Het
Atp5k	T	C	5: 108,434,059	I20V	probably benign	Het
Atp6v0d2	T	A	4: 19,922,605		probably null	Het
Bclaf1	T	G	10: 20,322,160		probably null	Het
Bod1l	A	G	5: 41,818,787	V1728A	probably benign	Het
Braf	A	G	6: 39,688,282	F51L	possibly damaging	Het
Camsap2	A	G	1: 136,304,437	I140T	possibly damaging	Het
Ccdc24	A	T	4: 117,869,653		probably null	Het
Cdh26	G	C	2: 178,449,884	G79R	probably damaging	Het
Cenpf	A	G	1: 189,652,742	L2447P	probably damaging	Het
Cfap74	T	C	4: 155,451,796	F863L	probably damaging	Het
Clstn2	C	T	9: 97,454,674	G917S	probably benign	Het
Col6a6	A	T	9: 105,727,227		probably null	Het
Cul5	G	A	9: 53,623,735	P596L	probably damaging	Het
Dst	A	T	1: 34,229,085	R2863W	probably damaging	Het
Dthd1	A	G	5: 62,814,041	E69G	possibly damaging	Het
Erich2	T	A	2: 70,539,684	I402N	probably damaging	Het
Fam160a1	G	A	3: 85,672,688	P737S	probably benign	Het
Fam162b	T	C	10: 51,585,502	K155R	probably damaging	Het
Glb1l2	A	T	9: 26,767,448	S466T	probably benign	Het
Gm21994	T	A	2: 150,255,278	Y77F	possibly damaging	Het
Gm5724	T	C	6: 141,725,393	D451G	probably damaging	Het
Ikbkap	A	T	4: 56,762,281	I1106K	probably damaging	Het
Kazn	G	A	4: 142,117,197	L402F	probably benign	Het
Kcnj13	A	T	1: 87,386,886	S205T	probably damaging	Het
Lama1	T	A	17: 67,810,096	V2462E	probably damaging	Het
Lce1b	A	C	3: 92,656,104	C41G	unknown	Het
Lyar	T	A	5: 38,225,995	W77R	probably damaging	Het
March11	G	A	15: 26,409,346	R377Q	probably benign	Het
Mis18bp1	A	G	12: 65,138,787	F869L	probably benign	Het
Myom1	T	A	17: 71,022,892	Y6*	probably null	Het
Myzap	T	C	9: 71,558,925	I150V	probably benign	Het
Nop14	C	T	5: 34,641,491		probably null	Het
Oprl1	T	A	2: 181,717,991		probably benign	Het
Pacsin1	T	C	17: 27,708,504	L432P	probably damaging	Het
Plcb2	C	T	2: 118,717,301	V482M	probably benign	Het
Pnliprp1	T	A	19: 58,734,984	I269N	probably damaging	Het
Pnpla7	C	A	2: 25,016,618	D664E	possibly damaging	Het
Ppa2	G	A	3: 133,370,417	R269H	probably benign	Het
Rps6kb2	G	T	19: 4,161,187	T113K	probably benign	Het
Rrp7a	A	T	15: 83,121,860	I63N	probably damaging	Het
Slc29a1	A	G	17: 45,589,921		probably null	Het
Stxbp5	A	C	10: 9,767,179	S1059A	probably benign	Het
Stxbp5	C	A	10: 9,767,187	G1056V	probably damaging	Het
Taldo1	T	A	7: 141,398,583	S149T	possibly damaging	Het
Tlr1	T	C	5: 64,927,099	D45G	possibly damaging	Het
Tnrc6a	T	C	7: 123,171,335	S783P	probably damaging	Het
Trap1	A	G	16: 4,060,809	Y220H	probably benign	Het
Trpc6	A	G	9: 8,643,600	D462G	possibly damaging	Het
Ttc21a	A	G	9: 119,943,962	E235G	probably damaging	Het
Tubb4a	A	G	17: 57,080,833	Y398H	probably damaging	Het
Ube2z	A	G	11: 96,050,407	F303S	probably damaging	Het
Vmn1r211	A	G	13: 22,852,084	S138P	probably damaging	Het
Zfp93	T	A	7: 24,275,629	C346*	probably null	Het
Zfp938	A	T	10: 82,227,566	S52R	possibly damaging	Het
Zp1	A	T	19: 10,916,503	L446Q	probably damaging	Het

Other mutations in Peak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Peak1	APN	9	56227326	missense	probably damaging	1.00
IGL00544:Peak1	APN	9	56259978	missense	probably damaging	1.00
IGL01141:Peak1	APN	9	56258527	missense	probably benign	0.01
IGL01743:Peak1	APN	9	56259202	missense	probably damaging	1.00
IGL01781:Peak1	APN	9	56260065	missense	possibly damaging	0.92
IGL01885:Peak1	APN	9	56260104	missense	probably damaging	1.00
IGL01941:Peak1	APN	9	56258775	missense	probably damaging	1.00
IGL02455:Peak1	APN	9	56227473	missense	possibly damaging	0.89
IGL02719:Peak1	APN	9	56227206	missense	probably damaging	1.00
IGL03247:Peak1	APN	9	56257930	missense	probably damaging	1.00
IGL03259:Peak1	APN	9	56259967	missense	probably damaging	1.00
R0060:Peak1	UTSW	9	56227823	missense	probably damaging	1.00
R0087:Peak1	UTSW	9	56258325	missense	probably damaging	1.00
R0480:Peak1	UTSW	9	56258632	missense	probably benign	0.00
R0569:Peak1	UTSW	9	56260089	missense	probably damaging	1.00
R0605:Peak1	UTSW	9	56227098	splice site	probably benign
R0865:Peak1	UTSW	9	56257832	missense	probably benign	0.02
R1117:Peak1	UTSW	9	56258418	missense	probably benign	0.05
R1922:Peak1	UTSW	9	56206687	missense	probably damaging	1.00
R1959:Peak1	UTSW	9	56206789	missense	probably damaging	1.00
R2069:Peak1	UTSW	9	56258759	missense	probably damaging	1.00
R2083:Peak1	UTSW	9	56258949	missense	probably damaging	1.00
R2154:Peak1	UTSW	9	56207212	missense	probably damaging	1.00
R2407:Peak1	UTSW	9	56259226	missense	probably damaging	1.00
R3832:Peak1	UTSW	9	56258383	missense	probably benign
R3938:Peak1	UTSW	9	56260365	missense	probably benign	0.01
R3964:Peak1	UTSW	9	56259979	missense	probably damaging	1.00
R4192:Peak1	UTSW	9	56258741	missense	probably damaging	1.00
R4381:Peak1	UTSW	9	56258427	missense	probably benign	0.34
R4869:Peak1	UTSW	9	56227592	missense	probably benign	0.06
R4994:Peak1	UTSW	9	56241276	missense	possibly damaging	0.65
R5062:Peak1	UTSW	9	56260289	missense	probably damaging	1.00
R5435:Peak1	UTSW	9	56206486	missense	probably damaging	0.98
R5632:Peak1	UTSW	9	56257774	missense	probably damaging	1.00
R5643:Peak1	UTSW	9	56258755	missense	probably damaging	0.99
R5880:Peak1	UTSW	9	56207610	missense	probably damaging	1.00
R5898:Peak1	UTSW	9	56207338	missense	probably benign	0.19
R5986:Peak1	UTSW	9	56259442	missense	probably benign	0.00
R6109:Peak1	UTSW	9	56259283	missense	probably benign	0.01
R6347:Peak1	UTSW	9	56258211	missense	probably benign	0.00
R6374:Peak1	UTSW	9	56257666	missense	probably damaging	1.00
R6471:Peak1	UTSW	9	56258259	missense	probably damaging	1.00
R6717:Peak1	UTSW	9	56207239	missense	probably benign	0.00
R7033:Peak1	UTSW	9	56259707	missense	probably damaging	1.00
R7039:Peak1	UTSW	9	56257809	missense	probably benign	0.01
R7100:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R7604:Peak1	UTSW	9	56241207	nonsense	probably null
R7868:Peak1	UTSW	9	56260470	missense	probably damaging	1.00
R7979:Peak1	UTSW	9	56207392	missense	possibly damaging	0.52
R8258:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8259:Peak1	UTSW	9	56259393	missense	probably damaging	1.00
R8272:Peak1	UTSW	9	56258898	missense	probably damaging	1.00
R8324:Peak1	UTSW	9	56207476	missense	probably damaging	1.00
R8516:Peak1	UTSW	9	56260000	missense	probably damaging	1.00
R8847:Peak1	UTSW	9	56207143	missense	probably damaging	1.00
R8895:Peak1	UTSW	9	56206654	missense	probably benign
R9082:Peak1	UTSW	9	56258220	missense	probably benign	0.07
R9138:Peak1	UTSW	9	56257641	missense	probably benign	0.34
R9355:Peak1	UTSW	9	56260170	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCAACGATCGTTTGTAGCAATC -3'
(R):5'- GTAACAACCACCGAGTCAGG -3'

Sequencing Primer
(F):5'- CCAAGAATGTTTCTCTGGCG -3'
(R):5'- TCAGGAGCACGGGCAACTTC -3'

Posted On

2018-03-15