Mutagenetix > Incidental Mutation

Incidental Mutation 'R6622:Zp2'

524524

Institutional Source

Beutler Lab

Gene Symbol

Zp2

Ensembl Gene

ENSMUSG00000030911

Gene Name

zona pellucida glycoprotein 2

Synonyms

Zp-2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R6622 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120126772-120145291 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120132525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 669 (E669G)

Ref Sequence

ENSEMBL: ENSMUSP00000033207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]

AlphaFold

P20239

Predicted Effect

probably benign
Transcript: ENSMUST00000033207
AA Change: E669G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: E669G

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
ZP	364	630	1.06e-86	SMART
low complexity region	655	668	N/A	INTRINSIC
transmembrane domain	684	703	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207726

Predicted Effect

probably benign
Transcript: ENSMUST00000208874

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	C	A	15: 8,244,222	A2563D	probably damaging	Het
6030419C18Rik	A	G	9: 58,499,250	I148V	probably benign	Het
Adgrl3	A	C	5: 81,794,759	D1412A	probably benign	Het
Arhgap26	A	G	18: 38,899,863		probably benign	Het
Card14	A	G	11: 119,333,988	M614V	probably benign	Het
Cbx2	A	G	11: 119,029,135	T509A	probably damaging	Het
Cep135	A	G	5: 76,640,968	D1136G	probably benign	Het
Cep170	T	A	1: 176,756,332	Q827L	probably damaging	Het
Clock	A	T	5: 76,241,954	I349K	probably damaging	Het
Cnppd1	A	T	1: 75,136,895	V243E	probably damaging	Het
Cops3	A	G	11: 59,833,134	F93L	probably damaging	Het
Cxxc5	T	G	18: 35,859,319	C258G	possibly damaging	Het
Cycs	G	A	6: 50,566,463		probably benign	Het
Cyp2c40	A	T	19: 39,802,546	H280Q	probably damaging	Het
Cyp4f14	C	T	17: 32,914,645	R79H	probably benign	Het
Dnajc27	A	G	12: 4,103,114	S197G	probably benign	Het
Dscam	C	T	16: 96,645,073	G1456E	probably benign	Het
Dst	G	A	1: 34,179,251	V1591I	probably benign	Het
Epha5	A	G	5: 84,237,528	S315P	possibly damaging	Het
Fam46a	G	T	9: 85,326,456	R105S	probably damaging	Het
Frmd4a	A	G	2: 4,606,062	T1012A	probably benign	Het
Fxr2	G	A	11: 69,641,590		probably null	Het
Gm12394	T	A	4: 42,793,111	L340F	probably damaging	Het
Hcn4	T	A	9: 58,857,727	V534E	unknown	Het
Hrh4	A	G	18: 13,022,397	Y331C	probably damaging	Het
Kif16b	T	A	2: 142,712,442	H812L	probably benign	Het
Krt14	T	A	11: 100,203,960	R451S	probably benign	Het
Man2b1	A	G	8: 85,084,479	T80A	probably damaging	Het
Nedd4l	A	G	18: 65,174,234	T383A	probably damaging	Het
Pcdha9	T	A	18: 36,998,654	L259M	possibly damaging	Het
Pdgfd	T	C	9: 6,293,818	C131R	probably damaging	Het
Prrc2a	C	G	17: 35,155,420	R1418P	probably damaging	Het
Ptpa	G	T	2: 30,437,577	E114D	probably damaging	Het
Ptprt	A	T	2: 161,553,840	C1157S	probably damaging	Het
Rnf126	A	T	10: 79,761,563		probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sel1l3	A	G	5: 53,139,860	V748A	probably damaging	Het
Serinc5	T	A	13: 92,688,686	S208T	probably benign	Het
Sftpb	A	G	6: 72,305,655	I74V	possibly damaging	Het
Slc22a14	A	C	9: 119,170,577	I516S	possibly damaging	Het
Slco2a1	G	A	9: 103,074,505	C411Y	possibly damaging	Het
Tet3	G	A	6: 83,403,444	P581S	probably benign	Het
Tmem231	T	C	8: 111,918,931	D112G	probably damaging	Het
Tnrc6b	T	A	15: 80,879,184	W296R	probably damaging	Het
Trpm1	T	A	7: 64,240,595	L982H	probably damaging	Het
Ttn	C	A	2: 76,720,518	R23183I	possibly damaging	Het
Tuft1	T	A	3: 94,635,419	Y46F	probably damaging	Het
Vmn1r167	T	A	7: 23,505,589	M1L	probably null	Het
Zfp808	A	G	13: 62,171,832	R292G	possibly damaging	Het

Other mutations in Zp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Zp2	APN	7	120133400	missense	probably benign	0.00
IGL00707:Zp2	APN	7	120133413	missense	probably benign	0.03
IGL00916:Zp2	APN	7	120138174	missense	probably damaging	1.00
IGL01554:Zp2	APN	7	120138325	missense	possibly damaging	0.78
IGL01845:Zp2	APN	7	120138191	missense	probably damaging	1.00
IGL02111:Zp2	APN	7	120132418	missense	possibly damaging	0.75
IGL02145:Zp2	APN	7	120139851	critical splice acceptor site	probably null
IGL02155:Zp2	APN	7	120144117	missense	probably benign	0.00
IGL02178:Zp2	APN	7	120133750	missense	possibly damaging	0.85
IGL02646:Zp2	APN	7	120135341	missense	possibly damaging	0.92
IGL03220:Zp2	APN	7	120137227	missense	possibly damaging	0.90
PIT4687001:Zp2	UTSW	7	120141879	missense	probably benign	0.00
R0138:Zp2	UTSW	7	120137200	missense	probably damaging	0.96
R0197:Zp2	UTSW	7	120143576	splice site	probably benign
R0519:Zp2	UTSW	7	120138149	missense	probably damaging	1.00
R0573:Zp2	UTSW	7	120135470	splice site	probably benign
R0879:Zp2	UTSW	7	120135534	missense	probably damaging	1.00
R0883:Zp2	UTSW	7	120143576	splice site	probably benign
R1160:Zp2	UTSW	7	120136045	missense	probably damaging	1.00
R1235:Zp2	UTSW	7	120138343	missense	possibly damaging	0.57
R1753:Zp2	UTSW	7	120138105	missense	probably benign
R1883:Zp2	UTSW	7	120133401	missense	probably benign	0.02
R1995:Zp2	UTSW	7	120135165	missense	probably damaging	0.97
R2196:Zp2	UTSW	7	120138306	missense	probably benign
R2850:Zp2	UTSW	7	120138306	missense	probably benign
R3715:Zp2	UTSW	7	120141834	missense	possibly damaging	0.95
R3931:Zp2	UTSW	7	120132357	intron	probably benign
R4082:Zp2	UTSW	7	120135252	missense	probably benign	0.01
R4731:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4732:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4733:Zp2	UTSW	7	120138120	missense	probably damaging	0.96
R4754:Zp2	UTSW	7	120138318	missense	probably benign	0.01
R4863:Zp2	UTSW	7	120135772	missense	probably damaging	1.00
R5274:Zp2	UTSW	7	120138092	missense	possibly damaging	0.92
R5392:Zp2	UTSW	7	120135764	nonsense	probably null
R5877:Zp2	UTSW	7	120133339	missense	probably null	0.94
R6390:Zp2	UTSW	7	120141230	missense	probably benign	0.23
R6404:Zp2	UTSW	7	120135542	missense	possibly damaging	0.73
R6546:Zp2	UTSW	7	120132525	missense	probably benign	0.00
R6622:Zp2	UTSW	7	120141913	missense	probably benign
R6707:Zp2	UTSW	7	120133922	missense	possibly damaging	0.85
R7274:Zp2	UTSW	7	120132391	makesense	probably null
R7275:Zp2	UTSW	7	120135353	splice site	probably null
R7541:Zp2	UTSW	7	120136056	missense	probably damaging	1.00
R7585:Zp2	UTSW	7	120133944	missense	probably damaging	1.00
R7709:Zp2	UTSW	7	120135775	missense	probably damaging	1.00
R7742:Zp2	UTSW	7	120132508	missense	unknown
R7767:Zp2	UTSW	7	120137169	missense	probably benign	0.01
R7771:Zp2	UTSW	7	120143642	missense	probably damaging	0.96
R8391:Zp2	UTSW	7	120126956	missense	probably benign	0.00
R8872:Zp2	UTSW	7	120133802	missense	probably benign	0.14
R8880:Zp2	UTSW	7	120143612	missense	possibly damaging	0.80
R9673:Zp2	UTSW	7	120134015	missense	probably damaging	1.00
X0017:Zp2	UTSW	7	120133385	missense	probably damaging	1.00
X0023:Zp2	UTSW	7	120133367	missense	probably damaging	1.00
Z1176:Zp2	UTSW	7	120135179	missense	not run
Z1177:Zp2	UTSW	7	120135179	missense	not run
Z1177:Zp2	UTSW	7	120135209	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAAGAGTTTAACTGCAGTCTC -3'
(R):5'- TCTCTCTAGGTATTGGCCAATCTGG -3'

Sequencing Primer
(F):5'- ACTGCAGTCTCTTTATTTGCAAG -3'
(R):5'- CCAATCTGGCTTGAGATGGG -3'

Posted On

2018-06-22