Incidental Mutation 'R6734:Galnt9'
ID528335
Institutional Source Beutler Lab
Gene Symbol Galnt9
Ensembl Gene ENSMUSG00000033316
Gene Namepolypeptide N-acetylgalactosaminyltransferase 9
SynonymsGalNAc-T9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6734 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location110544355-110621380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110620599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 587 (R587H)
Ref Sequence ENSEMBL: ENSMUSP00000038633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040001] [ENSMUST00000165856] [ENSMUST00000200404]
Predicted Effect probably damaging
Transcript: ENSMUST00000040001
AA Change: R587H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038633
Gene: ENSMUSG00000033316
AA Change: R587H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 4.3e-26 PFAM
Blast:UBCc 425 457 3e-6 BLAST
RICIN 466 596 6.74e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165856
AA Change: R220H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133111
Gene: ENSMUSG00000033316
AA Change: R220H

DomainStartEndE-ValueType
Blast:UBCc 58 90 1e-6 BLAST
RICIN 99 229 6.74e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200404
SMART Domains Protein: ENSMUSP00000143647
Gene: ENSMUSG00000033316

DomainStartEndE-ValueType
PDB:1XHB|A 1 132 7e-27 PDB
Blast:UBCc 58 90 2e-7 BLAST
SCOP:d1abrb1 92 133 8e-5 SMART
Blast:RICIN 99 136 1e-18 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Galnt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Galnt9 APN 5 110588322 missense probably damaging 1.00
IGL01934:Galnt9 APN 5 110602636 missense possibly damaging 0.56
IGL02394:Galnt9 APN 5 110615499 missense probably damaging 0.99
IGL02468:Galnt9 APN 5 110614223 missense possibly damaging 0.68
garnished UTSW 5 110588391 missense probably damaging 0.99
Spotless UTSW 5 110615509 missense probably damaging 1.00
varnished UTSW 5 110620599 missense probably damaging 1.00
R1494:Galnt9 UTSW 5 110588330 missense probably damaging 1.00
R1703:Galnt9 UTSW 5 110619172 missense probably damaging 1.00
R1717:Galnt9 UTSW 5 110596212 missense probably benign 0.01
R1806:Galnt9 UTSW 5 110619253 missense possibly damaging 0.77
R1855:Galnt9 UTSW 5 110615524 missense probably damaging 1.00
R4039:Galnt9 UTSW 5 110614208 missense probably damaging 1.00
R4388:Galnt9 UTSW 5 110588391 missense probably damaging 0.99
R4636:Galnt9 UTSW 5 110615499 missense probably damaging 0.99
R4693:Galnt9 UTSW 5 110615509 missense probably damaging 1.00
R4921:Galnt9 UTSW 5 110577449 missense probably damaging 0.96
R4925:Galnt9 UTSW 5 110544739 missense possibly damaging 0.54
R5040:Galnt9 UTSW 5 110617905 missense probably damaging 1.00
R5239:Galnt9 UTSW 5 110544769 missense probably damaging 1.00
R5839:Galnt9 UTSW 5 110577520 missense probably benign
R5918:Galnt9 UTSW 5 110615466 missense probably damaging 1.00
R6775:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6777:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6784:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R7214:Galnt9 UTSW 5 110589828 missense probably benign
R7340:Galnt9 UTSW 5 110614188 missense probably damaging 0.99
R7522:Galnt9 UTSW 5 110595839 intron probably null
Predicted Primers PCR Primer
(F):5'- TACAGTGGTAGTGCAGGAACC -3'
(R):5'- TCACAAAACCTAGCCCTGGG -3'

Sequencing Primer
(F):5'- CAGGATAAGGCTAGGATCACCC -3'
(R):5'- AAAACCTAGCCCTGGGGTGTG -3'
Posted On2018-07-24