Incidental Mutation 'R6724:Tacc2'
ID529764
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6724 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130728762 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 259 (R259G)
Ref Sequence ENSEMBL: ENSMUSP00000146718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033141] [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207282] [ENSMUST00000207376] [ENSMUST00000207395] [ENSMUST00000207549] [ENSMUST00000207789] [ENSMUST00000208722] [ENSMUST00000208743] [ENSMUST00000209108]
Predicted Effect probably damaging
Transcript: ENSMUST00000033141
AA Change: R149G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033141
Gene: ENSMUSG00000030852
AA Change: R149G

DomainStartEndE-ValueType
low complexity region 37 63 N/A INTRINSIC
internal_repeat_1 71 181 1.04e-5 PROSPERO
low complexity region 235 246 N/A INTRINSIC
internal_repeat_2 258 345 6.53e-5 PROSPERO
internal_repeat_1 373 456 1.04e-5 PROSPERO
low complexity region 461 476 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
low complexity region 538 552 N/A INTRINSIC
internal_repeat_2 629 716 6.53e-5 PROSPERO
coiled coil region 763 790 N/A INTRINSIC
Pfam:TACC 829 1035 3.4e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000059145
AA Change: R259G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852
AA Change: R259G

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084513
AA Change: R1966G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: R1966G

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207282
AA Change: R149G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000207376
Predicted Effect probably damaging
Transcript: ENSMUST00000207395
AA Change: R5G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207549
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably damaging
Transcript: ENSMUST00000208722
AA Change: R259G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208743
AA Change: R149G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209108
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 T A 16: 85,868,557 T619S probably benign Het
Adgra2 G A 8: 27,114,182 A467T possibly damaging Het
AF366264 A T 8: 13,837,083 L336Q probably damaging Het
Alox5 A T 6: 116,414,548 I416N probably damaging Het
Blmh A G 11: 76,971,907 probably null Het
Cftr T A 6: 18,255,974 Y567* probably null Het
Cnr1 T A 4: 33,944,728 M372K possibly damaging Het
Col6a3 T C 1: 90,779,152 T2080A unknown Het
Crybg3 A T 16: 59,544,138 C2374S probably benign Het
Csmd2 A G 4: 128,563,371 I3544V probably damaging Het
Dnah12 A T 14: 26,796,223 D1809V probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnajb12 A G 10: 59,892,780 D190G possibly damaging Het
Dtnb T A 12: 3,686,817 V319D probably damaging Het
Ercc6 A T 14: 32,566,331 E820V probably benign Het
Fip1l1 T G 5: 74,591,774 V378G probably damaging Het
Gabrg1 T A 5: 70,754,209 Y358F possibly damaging Het
Gcn1l1 T G 5: 115,609,158 probably null Het
Gm11011 T A 2: 169,587,482 T28S unknown Het
Gm13762 T G 2: 88,973,268 I208L probably benign Het
Gm14025 A C 2: 129,038,056 V650G probably benign Het
Gm4027 A T 12: 87,621,984 I129F unknown Het
Guf1 C A 5: 69,566,393 N438K probably damaging Het
Hoxa7 T C 6: 52,215,739 E223G probably benign Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ipo8 A T 6: 148,809,975 probably null Het
Isl2 A G 9: 55,541,288 D3G possibly damaging Het
Kcnb2 A G 1: 15,710,440 Y512C probably damaging Het
Kifc1 T A 17: 33,886,733 probably null Het
Klhdc10 A G 6: 30,446,641 D183G probably damaging Het
Klra5 T A 6: 129,906,680 K71N probably benign Het
Lrp6 T C 6: 134,486,541 H559R possibly damaging Het
Maml3 T C 3: 51,855,875 N556S probably damaging Het
Man2a1 A G 17: 64,731,269 I83V possibly damaging Het
Mrgpra9 A G 7: 47,235,038 S293P probably damaging Het
Nalcn A G 14: 123,298,067 S1282P probably damaging Het
Npepps A T 11: 97,206,002 probably benign Het
Olfr1037 A T 2: 86,085,357 V140E possibly damaging Het
Olfr1154 T G 2: 87,903,602 S25R probably benign Het
Olfr1245 A T 2: 89,574,965 F254I probably benign Het
Pkn3 C A 2: 30,090,550 R818S possibly damaging Het
Plekha3 T A 2: 76,687,401 H190Q probably damaging Het
Ppp2r3c A T 12: 55,288,496 S261T probably benign Het
Ptprj T C 2: 90,450,851 D1015G probably benign Het
Pus10 T C 11: 23,729,037 M503T possibly damaging Het
Pvr T C 7: 19,918,679 R104G possibly damaging Het
Rubcnl A G 14: 75,052,010 R653G probably benign Het
Serpina1a G T 12: 103,860,420 probably benign Het
Shank3 G A 15: 89,532,453 R265Q probably damaging Het
Slc22a22 C T 15: 57,247,532 R433H probably damaging Het
Slc22a26 A G 19: 7,802,361 I30T probably benign Het
Spz1 A T 13: 92,575,484 N161K possibly damaging Het
Top1 G A 2: 160,712,696 V456M probably damaging Het
Tpcn2 G A 7: 145,256,520 A649V probably benign Het
Trank1 C G 9: 111,365,916 R1003G probably damaging Het
Tril T A 6: 53,819,574 H221L possibly damaging Het
Unc79 C T 12: 103,104,861 T1305I probably damaging Het
Unc80 C T 1: 66,683,191 A2988V possibly damaging Het
Vmn1r81 A T 7: 12,260,672 M3K probably damaging Het
Vmn2r78 A T 7: 86,954,258 D548V probably damaging Het
Vwa3b G A 1: 37,045,031 R95Q probably damaging Het
Wdr6 G A 9: 108,574,894 H597Y probably benign Het
Yme1l1 C T 2: 23,194,762 T624I probably damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7651:Tacc2 UTSW 7 130623154 missense probably benign 0.25
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
R7861:Tacc2 UTSW 7 130625431 missense probably benign 0.00
R7944:Tacc2 UTSW 7 130625431 missense probably benign 0.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Z1176:Tacc2 UTSW 7 130623370 missense probably benign 0.01
Z1176:Tacc2 UTSW 7 130624270 missense possibly damaging 0.59
Z1176:Tacc2 UTSW 7 130744597 missense probably damaging 1.00
Z1177:Tacc2 UTSW 7 130624980 missense probably damaging 1.00
Z1177:Tacc2 UTSW 7 130625774 missense probably damaging 0.99
Z1177:Tacc2 UTSW 7 130734949 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGATGCATTTCTGAGCCACC -3'
(R):5'- TCGCTTAAGGGTGCTGGAAG -3'

Sequencing Primer
(F):5'- GCATTTCTGAGCCACCGGTTG -3'
(R):5'- CTGGAAGCACTGTTGGATCC -3'
Posted On2018-08-01