Mutagenetix > Incidental Mutation

Incidental Mutation 'R9264:Tacc2'

702427

Institutional Source

Beutler Lab

Gene Symbol

Tacc2

Ensembl Gene

ENSMUSG00000030852

Gene Name

transforming, acidic coiled-coil containing protein 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130577438-130764785 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 130626803 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1739 (K1739N)

Ref Sequence

ENSEMBL: ENSMUSP00000081561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000059145

SMART Domains

Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

Domain	Start	End	E-Value	Type
low complexity region	87	102	N/A	INTRINSIC
low complexity region	147	173	N/A	INTRINSIC
internal_repeat_1	181	291	2.03e-5	PROSPERO
low complexity region	345	356	N/A	INTRINSIC
internal_repeat_1	483	566	2.03e-5	PROSPERO
low complexity region	571	586	N/A	INTRINSIC
low complexity region	603	614	N/A	INTRINSIC
low complexity region	648	662	N/A	INTRINSIC
coiled coil region	873	900	N/A	INTRINSIC
Pfam:TACC	939	1145	4e-85	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000084513
AA Change: K1739N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: K1739N

Domain	Start	End	E-Value	Type
internal_repeat_1	19	346	3.83e-6	PROSPERO
low complexity region	398	410	N/A	INTRINSIC
low complexity region	413	431	N/A	INTRINSIC
internal_repeat_1	778	1068	3.83e-6	PROSPERO
low complexity region	1397	1415	N/A	INTRINSIC
low complexity region	1723	1739	N/A	INTRINSIC
low complexity region	1794	1809	N/A	INTRINSIC
low complexity region	1854	1880	N/A	INTRINSIC
low complexity region	2052	2063	N/A	INTRINSIC
low complexity region	2278	2293	N/A	INTRINSIC
low complexity region	2310	2321	N/A	INTRINSIC
low complexity region	2355	2369	N/A	INTRINSIC
coiled coil region	2606	2633	N/A	INTRINSIC
Pfam:TACC	2673	2873	6.1e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207789

Predicted Effect

probably damaging
Transcript: ENSMUST00000207918
AA Change: K1739N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000208722

Predicted Effect

probably damaging
Transcript: ENSMUST00000215492
AA Change: K1758N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,116,466	M1L	probably benign	Het
Abca15	A	T	7: 120,401,833	I1531L	probably benign	Het
Adam28	T	C	14: 68,607,465	Y791C	probably benign	Het
Ankrd40	T	A	11: 94,338,361	I262N	probably damaging	Het
BC067074	G	A	13: 113,319,480	V687M		Het
Catsperg2	A	T	7: 29,698,188	N1033K	possibly damaging	Het
Cdh10	A	T	15: 18,963,995	D81V	probably damaging	Het
Cep290	T	C	10: 100,498,016	V310A	possibly damaging	Het
Cep78	T	C	19: 15,974,466	Y325C	probably damaging	Het
Clstn3	T	A	6: 124,459,768	D197V	probably damaging	Het
Col11a1	T	C	3: 114,212,160	I1647T	unknown	Het
Col5a1	G	A	2: 27,964,111	R569K	unknown	Het
Cyp4a10	T	C	4: 115,524,278	S180P	probably benign	Het
D630045J12Rik	T	C	6: 38,158,238	I1336V	probably benign	Het
Dchs2	G	A	3: 83,270,477	V946M	probably damaging	Het
Dnah10	A	G	5: 124,736,836	R347G	probably damaging	Het
Dnah11	T	A	12: 118,027,527	D2368V	probably damaging	Het
Ganab	T	C	19: 8,912,864	I719T	possibly damaging	Het
Gm10944	C	A	10: 10,681,839	A11D	unknown	Het
Gmcl1	T	C	6: 86,714,213	M267V	probably benign	Het
Inhbe	T	A	10: 127,350,558	D251V	probably damaging	Het
Kcnj1	G	A	9: 32,396,358	R26Q	probably benign	Het
Lama5	A	G	2: 180,196,478		probably benign	Het
Lin9	T	A	1: 180,667,347	D251E	probably damaging	Het
Magel2	T	A	7: 62,378,596	I416N	possibly damaging	Het
Mdga2	T	C	12: 66,513,283	N772S	probably damaging	Het
Msh3	G	T	13: 92,349,304	Q171K	probably benign	Het
Mslnl	T	G	17: 25,742,532		probably benign	Het
Mtpn	A	G	6: 35,512,241	L116P	possibly damaging	Het
Myh7	T	C	14: 54,975,997	T1351A	probably benign	Het
Nectin3	A	T	16: 46,454,635	I353N	probably damaging	Het
Nprl3	A	T	11: 32,233,948	N500K	probably benign	Het
Nup93	T	A	8: 94,292,720	I181N	probably benign	Het
Olfr1198	T	C	2: 88,746,432	H152R	probably damaging	Het
Olfr362	G	A	2: 37,104,789	T287I	probably damaging	Het
Optc	T	C	1: 133,905,240	I41V	probably benign	Het
Pcdh7	C	A	5: 58,129,321	N1246K	probably benign	Het
Pcdhb3	T	A	18: 37,302,113	D377E	probably benign	Het
Pnpla6	C	T	8: 3,523,294	P386L	probably benign	Het
Polr3a	T	C	14: 24,470,831	T587A	probably benign	Het
Pramel1	T	G	4: 143,398,529	L341R	probably damaging	Het
Rhot2	A	T	17: 25,841,766	N210K	probably damaging	Het
Slc37a1	A	G	17: 31,300,485	I12V	probably benign	Het
Spata48	T	A	11: 11,464,678	D141E		Het
Sstr3	G	T	15: 78,539,592	N318K	probably damaging	Het
Ssx2ip	T	C	3: 146,437,200	V511A	probably benign	Het
Stfa1	G	A	16: 36,280,568	V57I	unknown	Het
Syne1	T	G	10: 5,262,793	R3265S	probably damaging	Het
Tas2r143	A	T	6: 42,400,739	M168L	probably benign	Het
Tm4sf1	A	T	3: 57,294,610		probably null	Het
Ttc16	A	G	2: 32,763,005	I604T	possibly damaging	Het
Ugt1a10	T	A	1: 88,055,671	W64R	possibly damaging	Het
Usp34	A	T	11: 23,489,064	H3561L		Het
Vasp	C	T	7: 19,259,451	V276I	unknown	Het
Vwa3a	A	G	7: 120,775,464	N333S	probably benign	Het
Wipf3	A	G	6: 54,483,881	N105D	probably benign	Het
Zfp760	T	C	17: 21,723,682	S613P	possibly damaging	Het

Other mutations in Tacc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Tacc2	APN	7	130759168	missense	probably damaging	1.00
IGL01396:Tacc2	APN	7	130759189	missense	probably damaging	0.98
IGL01621:Tacc2	APN	7	130729768	missense	probably damaging	0.99
IGL02000:Tacc2	APN	7	130729168	splice site	probably null
IGL02075:Tacc2	APN	7	130728852	missense	probably benign	0.03
IGL02201:Tacc2	APN	7	130626212	missense	possibly damaging	0.84
IGL02205:Tacc2	APN	7	130626682	missense	probably damaging	1.00
IGL02399:Tacc2	APN	7	130623399	missense	probably benign	0.15
IGL02456:Tacc2	APN	7	130626261	missense	probably benign	0.35
IGL02559:Tacc2	APN	7	130759267	missense	probably damaging	1.00
IGL02734:Tacc2	APN	7	130626099	missense	probably damaging	0.98
IGL02800:Tacc2	APN	7	130624079	missense	probably benign	0.40
IGL02938:Tacc2	APN	7	130728941	missense	probably damaging	1.00
IGL03031:Tacc2	APN	7	130623855	missense	possibly damaging	0.94
IGL03278:Tacc2	APN	7	130733568	critical splice donor site	probably null
IGL03283:Tacc2	APN	7	130742266	missense	possibly damaging	0.47
IGL03371:Tacc2	APN	7	130626061	missense	possibly damaging	0.90
aces	UTSW	7	130733528	missense	probably damaging	1.00
Jacks	UTSW	7	130625764	missense	probably damaging	0.98
kings	UTSW	7	130623483	missense	probably damaging	0.96
R0002:Tacc2	UTSW	7	130621785	missense	probably damaging	0.99
R0119:Tacc2	UTSW	7	130621875	missense	probably damaging	0.98
R0244:Tacc2	UTSW	7	130751825	splice site	probably benign
R0619:Tacc2	UTSW	7	130716753	missense	probably damaging	1.00
R0624:Tacc2	UTSW	7	130577509	missense	probably damaging	0.99
R0632:Tacc2	UTSW	7	130625595	nonsense	probably null
R1015:Tacc2	UTSW	7	130624065	missense	probably benign
R1081:Tacc2	UTSW	7	130728574	missense	possibly damaging	0.46
R1086:Tacc2	UTSW	7	130626497	missense	possibly damaging	0.94
R1351:Tacc2	UTSW	7	130663003	intron	probably benign
R1538:Tacc2	UTSW	7	130625419	missense	probably benign	0.03
R1743:Tacc2	UTSW	7	130626598	nonsense	probably null
R1771:Tacc2	UTSW	7	130742240	missense	probably damaging	1.00
R1876:Tacc2	UTSW	7	130623745	missense	probably benign	0.38
R1893:Tacc2	UTSW	7	130625325	missense	probably benign	0.01
R1899:Tacc2	UTSW	7	130624202	missense	possibly damaging	0.81
R2005:Tacc2	UTSW	7	130731550	missense	probably damaging	1.00
R2131:Tacc2	UTSW	7	130621857	missense	possibly damaging	0.90
R2338:Tacc2	UTSW	7	130733569	splice site	probably null
R2407:Tacc2	UTSW	7	130622040	missense	possibly damaging	0.65
R3051:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3052:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3053:Tacc2	UTSW	7	130625496	missense	possibly damaging	0.81
R3116:Tacc2	UTSW	7	130759249	missense	probably damaging	1.00
R3412:Tacc2	UTSW	7	130734994	missense	probably benign	0.02
R3683:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3685:Tacc2	UTSW	7	130625070	missense	probably benign	0.40
R3872:Tacc2	UTSW	7	130622422	missense	probably benign	0.02
R4063:Tacc2	UTSW	7	130729122	missense	probably damaging	0.97
R4410:Tacc2	UTSW	7	130742211	missense	possibly damaging	0.80
R4434:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4438:Tacc2	UTSW	7	130623541	missense	probably damaging	0.96
R4618:Tacc2	UTSW	7	130626216	missense	probably benign	0.10
R4674:Tacc2	UTSW	7	130624861	missense	possibly damaging	0.75
R4742:Tacc2	UTSW	7	130625967	missense	probably benign	0.00
R4934:Tacc2	UTSW	7	130728588	missense	probably damaging	1.00
R4947:Tacc2	UTSW	7	130625899	missense	probably damaging	0.98
R4964:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4966:Tacc2	UTSW	7	130728777	missense	probably damaging	1.00
R4967:Tacc2	UTSW	7	130623948	missense	probably damaging	0.99
R5052:Tacc2	UTSW	7	130735014	missense	probably damaging	1.00
R5276:Tacc2	UTSW	7	130729317	missense	probably damaging	1.00
R5330:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5331:Tacc2	UTSW	7	130733528	missense	probably damaging	1.00
R5372:Tacc2	UTSW	7	130623260	missense	probably benign	0.09
R5556:Tacc2	UTSW	7	130674606	missense	probably damaging	0.97
R5645:Tacc2	UTSW	7	130624051	missense	possibly damaging	0.80
R5886:Tacc2	UTSW	7	130729120	missense	probably benign	0.18
R5996:Tacc2	UTSW	7	130623483	missense	probably damaging	0.96
R6074:Tacc2	UTSW	7	130625435	missense	possibly damaging	0.92
R6127:Tacc2	UTSW	7	130626115	missense	possibly damaging	0.92
R6156:Tacc2	UTSW	7	130625764	missense	probably damaging	0.98
R6298:Tacc2	UTSW	7	130626525	missense	probably benign	0.26
R6444:Tacc2	UTSW	7	130623412	missense	possibly damaging	0.46
R6533:Tacc2	UTSW	7	130622837	missense	possibly damaging	0.94
R6724:Tacc2	UTSW	7	130728762	missense	probably damaging	1.00
R7111:Tacc2	UTSW	7	130728888	missense	probably benign	0.16
R7150:Tacc2	UTSW	7	130729077	missense	probably benign
R7290:Tacc2	UTSW	7	130729373	missense	probably benign	0.07
R7404:Tacc2	UTSW	7	130623336	missense	probably benign	0.22
R7460:Tacc2	UTSW	7	130624633	missense	probably benign	0.39
R7651:Tacc2	UTSW	7	130623154	missense	probably benign	0.25
R7666:Tacc2	UTSW	7	130716814	start gained	probably benign
R7695:Tacc2	UTSW	7	130728903	missense	probably benign	0.08
R7766:Tacc2	UTSW	7	130743598	missense	probably damaging	1.00
R7793:Tacc2	UTSW	7	130623113	missense	probably benign	0.34
R7861:Tacc2	UTSW	7	130625431	missense	probably benign	0.00
R8204:Tacc2	UTSW	7	130624429	missense	probably damaging	0.97
R8244:Tacc2	UTSW	7	130728676	missense	probably damaging	1.00
R8245:Tacc2	UTSW	7	130729573	missense	probably damaging	1.00
R8283:Tacc2	UTSW	7	130625304	missense	probably benign	0.02
R8348:Tacc2	UTSW	7	130623289	missense	possibly damaging	0.84
R8369:Tacc2	UTSW	7	130622158	missense	probably damaging	0.98
R8381:Tacc2	UTSW	7	130624242	missense	probably benign	0.00
R8804:Tacc2	UTSW	7	130692963	missense	probably benign
R8809:Tacc2	UTSW	7	130674691	missense	possibly damaging	0.94
R8835:Tacc2	UTSW	7	130626528	missense	probably benign	0.00
R8880:Tacc2	UTSW	7	130716834	missense	possibly damaging	0.86
R8918:Tacc2	UTSW	7	130626093	missense	probably benign	0.00
R8936:Tacc2	UTSW	7	130626637	missense	possibly damaging	0.94
R8953:Tacc2	UTSW	7	130625757	missense	probably benign	0.00
R9026:Tacc2	UTSW	7	130623536	missense	probably damaging	1.00
R9193:Tacc2	UTSW	7	130626574	missense	probably benign	0.04
R9221:Tacc2	UTSW	7	130624328	missense	probably damaging	0.98
R9221:Tacc2	UTSW	7	130624479	missense	probably benign	0.00
R9222:Tacc2	UTSW	7	130626255	missense	probably benign	0.00
R9312:Tacc2	UTSW	7	130622248	missense	probably benign	0.00
R9380:Tacc2	UTSW	7	130625041	missense	possibly damaging	0.86
R9515:Tacc2	UTSW	7	130764311	missense	probably damaging	1.00
R9705:Tacc2	UTSW	7	130759288	missense	probably damaging	1.00
X0010:Tacc2	UTSW	7	130735057	missense	probably damaging	1.00
Z1176:Tacc2	UTSW	7	130623370	missense	probably benign	0.01
Z1176:Tacc2	UTSW	7	130624270	missense	possibly damaging	0.59
Z1176:Tacc2	UTSW	7	130744597	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130624980	missense	probably damaging	1.00
Z1177:Tacc2	UTSW	7	130625774	missense	probably damaging	0.99
Z1177:Tacc2	UTSW	7	130734949	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTAACTCAGCACATCCTGGGAG -3'
(R):5'- ATCCTAGCAATCCAGAGAGGG -3'

Sequencing Primer
(F):5'- ACTCAGGATGTTCTAACAGGGCTC -3'
(R):5'- GTAAATGGGGCCACTTAACCCTTC -3'

Posted On

2022-03-25