Incidental Mutation 'R6954:Gm29106'
ID 541348
Institutional Source Beutler Lab
Gene Symbol Gm29106
Ensembl Gene ENSMUSG00000102030
Gene Name predicted gene 29106
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R6954 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 118176542-118202307 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118200587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 670 (C670S)
Ref Sequence ENSEMBL: ENSMUSP00000141137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186264]
AlphaFold A0A087WSP8
Predicted Effect probably damaging
Transcript: ENSMUST00000186264
AA Change: C670S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141137
Gene: ENSMUSG00000102030
AA Change: C670S

DomainStartEndE-ValueType
KRAB 8 66 2.8e-24 SMART
ZnF_C2H2 77 97 2.3e-2 SMART
ZnF_C2H2 105 127 4.5e-6 SMART
ZnF_C2H2 133 155 3.4e-6 SMART
ZnF_C2H2 161 183 3.2e-7 SMART
ZnF_C2H2 189 211 2.1e-4 SMART
ZnF_C2H2 217 239 6.3e-7 SMART
ZnF_C2H2 245 267 3.4e-6 SMART
ZnF_C2H2 273 295 3.2e-7 SMART
ZnF_C2H2 301 323 2.1e-4 SMART
ZnF_C2H2 329 351 6.3e-7 SMART
ZnF_C2H2 357 379 2.1e-4 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 1.1e-7 SMART
ZnF_C2H2 441 463 4e-5 SMART
ZnF_C2H2 469 491 1.3e-6 SMART
ZnF_C2H2 497 519 2.4e-6 SMART
ZnF_C2H2 525 547 2.3e-4 SMART
ZnF_C2H2 553 575 1.4e-4 SMART
ZnF_C2H2 581 603 1.9e-6 SMART
ZnF_C2H2 609 631 5.2e-5 SMART
ZnF_C2H2 637 659 1.7e-5 SMART
ZnF_C2H2 665 687 9.4e-7 SMART
Meta Mutation Damage Score 0.1600 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Gm29106
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4985:Gm29106 UTSW 1 118199220 missense probably benign 0.02
R4991:Gm29106 UTSW 1 118178391 missense probably benign 0.01
R6029:Gm29106 UTSW 1 118200260 missense probably damaging 1.00
R6922:Gm29106 UTSW 1 118199794 missense probably damaging 0.98
R6961:Gm29106 UTSW 1 118200398 nonsense probably null
R7232:Gm29106 UTSW 1 118199561 missense probably damaging 1.00
R7337:Gm29106 UTSW 1 118176912 missense unknown
R7457:Gm29106 UTSW 1 118199252 missense probably damaging 1.00
R7662:Gm29106 UTSW 1 118199407 missense possibly damaging 0.89
R7870:Gm29106 UTSW 1 118199155 missense possibly damaging 0.55
R7894:Gm29106 UTSW 1 118199535 missense probably damaging 1.00
R7986:Gm29106 UTSW 1 118200270 missense possibly damaging 0.62
R8099:Gm29106 UTSW 1 118198791 missense probably benign 0.00
R8377:Gm29106 UTSW 1 118198863 missense probably damaging 0.99
R8498:Gm29106 UTSW 1 118200488 missense probably damaging 1.00
R8553:Gm29106 UTSW 1 118200419 missense probably damaging 1.00
R8980:Gm29106 UTSW 1 118199384 missense possibly damaging 0.86
R9212:Gm29106 UTSW 1 118199540 missense probably damaging 1.00
R9451:Gm29106 UTSW 1 118199914 missense possibly damaging 0.66
R9746:Gm29106 UTSW 1 118199524 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTGGAGACAAACCATACAAATGTAAT -3'
(R):5'- GTTGTCTCCTGTATGGATTCTCT -3'

Sequencing Primer
(F):5'- GTTCACCACAGATTACATACTGGAG -3'
(R):5'- CTCCTGTATGGATTCTCTGGTGAAC -3'
Posted On 2018-11-28