Incidental Mutation 'R6954:Slc25a10'
ID541384
Institutional Source Beutler Lab
Gene Symbol Slc25a10
Ensembl Gene ENSMUSG00000025792
Gene Namesolute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
SynonymsDic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120491840-120499187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120498147 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 279 (H279R)
Ref Sequence ENSEMBL: ENSMUSP00000026899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026899]
Predicted Effect probably benign
Transcript: ENSMUST00000026899
AA Change: H279R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026899
Gene: ENSMUSG00000025792
AA Change: H279R

DomainStartEndE-ValueType
Pfam:Mito_carr 5 92 4.1e-20 PFAM
Pfam:Mito_carr 94 191 2e-18 PFAM
Pfam:Mito_carr 195 284 7.2e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Slc25a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc25a10 APN 11 120497107 critical splice donor site probably null
IGL00816:Slc25a10 APN 11 120495150 splice site probably benign
IGL02448:Slc25a10 APN 11 120497053 missense probably benign 0.01
R2291:Slc25a10 UTSW 11 120497074 missense probably benign
R2860:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R2861:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R3938:Slc25a10 UTSW 11 120491993 nonsense probably null
R4019:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4020:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4457:Slc25a10 UTSW 11 120497089 missense probably benign
R4542:Slc25a10 UTSW 11 120497981 splice site probably null
R5643:Slc25a10 UTSW 11 120496376 intron probably benign
R5869:Slc25a10 UTSW 11 120498117 missense probably damaging 0.98
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6455:Slc25a10 UTSW 11 120495205 missense probably damaging 1.00
R6574:Slc25a10 UTSW 11 120497077 missense probably benign
R7302:Slc25a10 UTSW 11 120491956 unclassified probably benign
R7671:Slc25a10 UTSW 11 120495460 missense probably benign 0.18
R7883:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
R7966:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGACAGCAAAGCTTGGACCC -3'
(R):5'- ACCTCTTCTGAGTGAATCATCG -3'

Sequencing Primer
(F):5'- GGACCCCAGGCCTTTTTCAAG -3'
(R):5'- CCTCTTCTGAGTGAATCATCGGATAG -3'
Posted On2018-11-28