Incidental Mutation 'R6954:Pkdrej'
ID 541393
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Name polycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission 045066-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R6954 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85698877-85705934 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 85702054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 1294 (L1294*)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000064370
AA Change: L1294*
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: L1294*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,429,809 (GRCm39) probably null Het
Alox5 A C 6: 116,397,241 (GRCm39) Y314* probably null Het
Ap4e1 T C 2: 126,906,871 (GRCm39) S1044P probably benign Het
Ash2l A G 8: 26,312,796 (GRCm39) V391A possibly damaging Het
B4galnt4 A G 7: 140,647,145 (GRCm39) T326A probably benign Het
Ccm2 T A 11: 6,544,239 (GRCm39) I345N probably damaging Het
Cntnap3 G A 13: 64,896,373 (GRCm39) H1034Y probably benign Het
Cpsf1 A G 15: 76,483,696 (GRCm39) L849S probably damaging Het
Ctrb1 A G 8: 112,413,296 (GRCm39) S239P probably damaging Het
Dennd1b T A 1: 139,096,683 (GRCm39) probably benign Het
Dnah17 A G 11: 117,957,258 (GRCm39) I2773T probably damaging Het
Eif2b2 T A 12: 85,272,817 (GRCm39) F267L probably damaging Het
Fcrl2 A G 3: 87,170,983 (GRCm39) probably benign Het
Furin G T 7: 80,046,712 (GRCm39) D181E possibly damaging Het
Gm29106 T A 1: 118,128,317 (GRCm39) C670S probably damaging Het
Gm6309 A T 5: 146,105,300 (GRCm39) D204E possibly damaging Het
Hsf2 T A 10: 57,380,739 (GRCm39) I191N probably damaging Het
Hspa12a T C 19: 58,788,124 (GRCm39) D566G probably benign Het
Igf1 G C 10: 87,700,722 (GRCm39) V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 (GRCm39) C44Y probably damaging Het
Letm1 G A 5: 33,939,851 (GRCm39) R16C probably benign Het
Lypd8l T A 11: 58,499,314 (GRCm39) Y168F probably benign Het
Marf1 A G 16: 13,956,384 (GRCm39) V819A probably damaging Het
Mfsd4b4 A T 10: 39,767,948 (GRCm39) S428T probably benign Het
Myo1d T C 11: 80,565,783 (GRCm39) I347M probably benign Het
Myo9b A G 8: 71,743,463 (GRCm39) I175V probably damaging Het
Naip5 A T 13: 100,359,922 (GRCm39) V438E probably damaging Het
Nup205 T A 6: 35,185,044 (GRCm39) V768E possibly damaging Het
Or4k6 A T 14: 50,475,567 (GRCm39) Y258* probably null Het
Or9g4b T A 2: 85,616,726 (GRCm39) Y290* probably null Het
Pcdh15 C T 10: 74,481,821 (GRCm39) H1651Y possibly damaging Het
Pdgfra A T 5: 75,334,055 (GRCm39) Q376L possibly damaging Het
Pign T C 1: 105,481,622 (GRCm39) I791M probably benign Het
Pik3c2b T G 1: 132,994,041 (GRCm39) S2A possibly damaging Het
Pip5k1a A T 3: 94,975,558 (GRCm39) I304K probably damaging Het
Pprc1 T C 19: 46,052,872 (GRCm39) S797P probably damaging Het
Prob1 A G 18: 35,787,321 (GRCm39) V311A probably benign Het
Prune2 C A 19: 16,977,385 (GRCm39) T40K probably damaging Het
Rif1 T G 2: 52,002,703 (GRCm39) D2052E probably benign Het
Sall1 A G 8: 89,759,519 (GRCm39) V195A probably damaging Het
Scfd1 T C 12: 51,474,729 (GRCm39) probably null Het
Sidt2 A T 9: 45,864,148 (GRCm39) N123K probably benign Het
Slc22a6 G A 19: 8,599,460 (GRCm39) A320T probably benign Het
Slc25a10 A G 11: 120,388,973 (GRCm39) H279R probably benign Het
Slc35b4 A G 6: 34,135,556 (GRCm39) V252A probably benign Het
Slc46a3 T C 5: 147,823,150 (GRCm39) T231A probably benign Het
Stxbp1 T A 2: 32,691,905 (GRCm39) H429L probably damaging Het
Tas2r134 C T 2: 51,517,782 (GRCm39) T87I probably benign Het
Tcstv6 A G 13: 120,307,666 (GRCm39) D20G possibly damaging Het
Tdpoz2 A T 3: 93,559,582 (GRCm39) L130H probably damaging Het
Tmem69 T C 4: 116,411,921 (GRCm39) probably null Het
Tmppe G A 9: 114,234,591 (GRCm39) V297I probably benign Het
Ung G T 5: 114,269,398 (GRCm39) A37S probably benign Het
Vdac1 T C 11: 52,277,200 (GRCm39) Y237H probably damaging Het
Vgll4 T C 6: 114,898,328 (GRCm39) Y11C probably damaging Het
Vmn1r24 A G 6: 57,933,437 (GRCm39) I27T probably benign Het
Zfp280b T A 10: 75,875,522 (GRCm39) M467K probably benign Het
Zkscan4 A G 13: 21,668,535 (GRCm39) I329V probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85,701,427 (GRCm39) missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85,703,857 (GRCm39) missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85,700,360 (GRCm39) missense probably benign 0.22
IGL01461:Pkdrej APN 15 85,704,575 (GRCm39) missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85,702,264 (GRCm39) missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85,701,901 (GRCm39) missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85,705,159 (GRCm39) missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85,700,489 (GRCm39) missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85,699,994 (GRCm39) missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85,705,528 (GRCm39) missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85,702,049 (GRCm39) missense probably benign
IGL02708:Pkdrej APN 15 85,704,988 (GRCm39) missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85,703,895 (GRCm39) missense probably benign 0.41
IGL02741:Pkdrej APN 15 85,701,631 (GRCm39) missense probably benign 0.04
IGL02882:Pkdrej APN 15 85,701,497 (GRCm39) missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85,700,382 (GRCm39) nonsense probably null
IGL03250:Pkdrej APN 15 85,705,556 (GRCm39) missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85,703,881 (GRCm39) small insertion probably benign
FR4737:Pkdrej UTSW 15 85,703,881 (GRCm39) small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85,705,493 (GRCm39) missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85,704,136 (GRCm39) missense probably benign 0.01
R0004:Pkdrej UTSW 15 85,702,384 (GRCm39) missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85,701,746 (GRCm39) nonsense probably null
R0117:Pkdrej UTSW 15 85,700,300 (GRCm39) splice site probably null
R0137:Pkdrej UTSW 15 85,705,768 (GRCm39) missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85,699,831 (GRCm39) missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85,703,752 (GRCm39) missense probably benign 0.08
R0714:Pkdrej UTSW 15 85,699,712 (GRCm39) missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R0750:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R0755:Pkdrej UTSW 15 85,700,336 (GRCm39) missense probably benign 0.00
R0938:Pkdrej UTSW 15 85,702,364 (GRCm39) missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85,700,515 (GRCm39) missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85,702,513 (GRCm39) missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85,703,119 (GRCm39) missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85,701,334 (GRCm39) missense probably benign 0.37
R1510:Pkdrej UTSW 15 85,700,963 (GRCm39) missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R1588:Pkdrej UTSW 15 85,701,442 (GRCm39) missense probably benign 0.44
R1739:Pkdrej UTSW 15 85,704,628 (GRCm39) missense probably benign 0.03
R1779:Pkdrej UTSW 15 85,705,372 (GRCm39) missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85,705,372 (GRCm39) missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85,703,483 (GRCm39) missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85,704,525 (GRCm39) nonsense probably null
R1870:Pkdrej UTSW 15 85,700,632 (GRCm39) missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85,703,368 (GRCm39) missense probably benign 0.00
R2069:Pkdrej UTSW 15 85,705,432 (GRCm39) missense probably benign 0.01
R2113:Pkdrej UTSW 15 85,703,185 (GRCm39) missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85,700,707 (GRCm39) missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85,701,773 (GRCm39) nonsense probably null
R2991:Pkdrej UTSW 15 85,704,137 (GRCm39) missense probably benign 0.00
R3029:Pkdrej UTSW 15 85,701,205 (GRCm39) missense probably benign 0.16
R3162:Pkdrej UTSW 15 85,700,818 (GRCm39) missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85,700,818 (GRCm39) missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85,701,693 (GRCm39) missense probably benign 0.02
R4169:Pkdrej UTSW 15 85,700,515 (GRCm39) missense probably benign 0.24
R4241:Pkdrej UTSW 15 85,702,345 (GRCm39) missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85,702,345 (GRCm39) missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85,705,368 (GRCm39) nonsense probably null
R4939:Pkdrej UTSW 15 85,704,484 (GRCm39) missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85,700,602 (GRCm39) missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85,704,610 (GRCm39) missense probably benign 0.00
R4982:Pkdrej UTSW 15 85,703,197 (GRCm39) missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85,700,585 (GRCm39) missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85,702,528 (GRCm39) missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85,701,319 (GRCm39) missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85,704,638 (GRCm39) missense probably benign
R5909:Pkdrej UTSW 15 85,702,497 (GRCm39) missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85,699,654 (GRCm39) missense probably benign 0.01
R6037:Pkdrej UTSW 15 85,703,967 (GRCm39) missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85,703,967 (GRCm39) missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85,700,585 (GRCm39) missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85,705,306 (GRCm39) nonsense probably null
R6500:Pkdrej UTSW 15 85,703,747 (GRCm39) missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85,701,510 (GRCm39) nonsense probably null
R6786:Pkdrej UTSW 15 85,702,850 (GRCm39) missense probably benign
R6866:Pkdrej UTSW 15 85,705,082 (GRCm39) missense probably damaging 1.00
R7086:Pkdrej UTSW 15 85,704,317 (GRCm39) missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85,700,389 (GRCm39) missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85,705,349 (GRCm39) missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85,705,301 (GRCm39) missense probably benign
R7549:Pkdrej UTSW 15 85,703,994 (GRCm39) missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85,703,122 (GRCm39) missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85,699,788 (GRCm39) missense probably benign 0.01
R7791:Pkdrej UTSW 15 85,700,132 (GRCm39) missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85,700,724 (GRCm39) missense probably benign 0.29
R8121:Pkdrej UTSW 15 85,699,655 (GRCm39) missense probably benign 0.00
R8140:Pkdrej UTSW 15 85,702,611 (GRCm39) missense probably damaging 1.00
R8219:Pkdrej UTSW 15 85,705,493 (GRCm39) missense probably damaging 0.99
R8222:Pkdrej UTSW 15 85,701,640 (GRCm39) missense probably benign
R8432:Pkdrej UTSW 15 85,701,494 (GRCm39) missense probably benign 0.00
R8755:Pkdrej UTSW 15 85,703,807 (GRCm39) missense probably benign 0.00
R8786:Pkdrej UTSW 15 85,704,044 (GRCm39) missense probably benign 0.01
R8817:Pkdrej UTSW 15 85,702,774 (GRCm39) missense probably damaging 1.00
R8827:Pkdrej UTSW 15 85,699,732 (GRCm39) missense possibly damaging 0.76
R8966:Pkdrej UTSW 15 85,702,012 (GRCm39) missense probably damaging 0.99
R8988:Pkdrej UTSW 15 85,700,538 (GRCm39) missense probably damaging 0.99
R9028:Pkdrej UTSW 15 85,701,098 (GRCm39) missense probably damaging 1.00
R9257:Pkdrej UTSW 15 85,700,098 (GRCm39) missense probably damaging 1.00
R9279:Pkdrej UTSW 15 85,700,834 (GRCm39) missense probably damaging 1.00
R9404:Pkdrej UTSW 15 85,703,270 (GRCm39) missense probably benign 0.39
R9433:Pkdrej UTSW 15 85,704,070 (GRCm39) missense probably benign 0.03
R9454:Pkdrej UTSW 15 85,702,420 (GRCm39) missense probably benign 0.05
R9479:Pkdrej UTSW 15 85,699,571 (GRCm39) missense possibly damaging 0.64
R9720:Pkdrej UTSW 15 85,702,497 (GRCm39) missense possibly damaging 0.82
R9748:Pkdrej UTSW 15 85,704,871 (GRCm39) missense possibly damaging 0.91
R9760:Pkdrej UTSW 15 85,705,268 (GRCm39) missense probably benign 0.30
Z1177:Pkdrej UTSW 15 85,700,738 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCAATCGCTCTTTCCAGG -3'
(R):5'- TGAGCCTCTGAAAAGGACAG -3'

Sequencing Primer
(F):5'- ATCGCTCTTTCCAGGACAGAC -3'
(R):5'- GCCTCTGAAAAGGACAGACTTCTTC -3'
Posted On 2018-11-28