Incidental Mutation 'R1918:Celsr2'
ID212683
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Namecadherin, EGF LAG seven-pass G-type receptor 2
Synonymsmfmi1, EGFL2, flamingo
MMRRC Submission 039936-MU
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108390851-108415552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108398650 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 2046 (G2046D)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
Predicted Effect probably benign
Transcript: ENSMUST00000090558
AA Change: G2046D

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: G2046D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130941
Predicted Effect unknown
Transcript: ENSMUST00000147251
AA Change: G34D
SMART Domains Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: G34D

DomainStartEndE-ValueType
Pfam:GAIN 35 278 5.1e-63 PFAM
GPS 304 357 1.86e-25 SMART
Pfam:7tm_2 362 594 2e-49 PFAM
low complexity region 704 722 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 863 870 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147565
SMART Domains Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

DomainStartEndE-ValueType
EGF 13 46 8e-5 SMART
LamG 72 206 1.56e-24 SMART
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Ctnnb1 C T 9: 120,951,034 P128S possibly damaging Het
Cyp11a1 A G 9: 58,026,757 I496V probably damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Ryr2 T A 13: 11,556,698 T4885S possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Strn4 T A 7: 16,833,921 Y507N probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp592 C T 7: 81,037,420 Q824* probably null Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCTGTGTGGCGGATAG -3'
(R):5'- GGGCTTCGTAAGTTGATCCCTC -3'

Sequencing Primer
(F):5'- GCGGATAGCCCAAAGCC -3'
(R):5'- CACACCCTTGTCTTTGGAAGTAGAG -3'
Posted On2014-07-14