Mutagenetix > Incidental Mutation

Incidental Mutation 'R1918:Celsr2'

212683

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

039936-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1918 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108398650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 2046 (G2046D)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090558
AA Change: G2046D

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: G2046D

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130941

Predicted Effect

unknown
Transcript: ENSMUST00000147251
AA Change: G34D

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740
AA Change: G34D

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147565

SMART Domains

Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
EGF	13	46	8e-5	SMART
LamG	72	206	1.56e-24	SMART

Meta Mutation Damage Score

0.1052

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110035E14Rik	T	C	1: 9,601,627	F15S	probably damaging	Het
4930432E11Rik	T	G	7: 29,574,089		noncoding transcript	Het
4930435E12Rik	A	G	16: 38,828,088	Y220H	possibly damaging	Het
4931440F15Rik	A	G	11: 29,824,039	S473P	probably benign	Het
A2m	T	C	6: 121,644,936	S314P	probably benign	Het
Abcc9	T	A	6: 142,697,682	I47F	probably damaging	Het
Abcd2	C	T	15: 91,191,481	R43H	probably benign	Het
Adgre5	A	G	8: 83,729,109	V190A	probably damaging	Het
Aen	C	T	7: 78,906,029	H242Y	possibly damaging	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap10	T	C	8: 77,259,079	I698V	probably benign	Het
Arpp21	C	T	9: 112,119,178		probably benign	Het
Atp10a	T	C	7: 58,827,935	I1294T	possibly damaging	Het
Atp13a2	T	C	4: 140,996,371	Y337H	possibly damaging	Het
BC147527	T	C	13: 120,308,222	L26P	probably damaging	Het
Bsn	C	T	9: 108,107,573	G3094D	unknown	Het
Cadm2	G	A	16: 66,747,384		probably benign	Het
Cadps	T	C	14: 12,546,372	M495V	probably damaging	Het
Cass4	A	G	2: 172,427,339	H447R	possibly damaging	Het
Ccdc124	C	A	8: 70,868,944	R108L	probably benign	Het
Ccdc141	C	T	2: 77,014,703	R1340Q	probably benign	Het
Ccdc148	T	G	2: 58,982,899	R299S	probably damaging	Het
Ccdc36	T	A	9: 108,412,985	H140L	probably benign	Het
Cd300lg	A	G	11: 102,054,110	E382G	probably damaging	Het
Cd36	A	T	5: 17,797,036	C322*	probably null	Het
Clasrp	C	T	7: 19,585,263	W492*	probably null	Het
Cmtr1	T	C	17: 29,679,009	V154A	possibly damaging	Het
Ctnnb1	C	T	9: 120,951,034	P128S	possibly damaging	Het
Cyp11a1	A	G	9: 58,026,757	I496V	probably damaging	Het
Disp2	G	A	2: 118,791,927	V1047I	probably benign	Het
Eps8l2	T	C	7: 141,361,724	V636A	probably damaging	Het
Fars2	T	C	13: 36,204,546	L6P	probably damaging	Het
Fnip1	C	T	11: 54,480,684	T177I	probably damaging	Het
Fut8	G	T	12: 77,332,218	R31L	probably benign	Het
G6pd2	T	C	5: 61,810,321	F480L	probably benign	Het
Glipr1l2	T	A	10: 112,092,645	C148*	probably null	Het
Gm10142	G	A	10: 77,715,987	V61M	probably benign	Het
Gm12169	A	G	11: 46,528,531	D58G	possibly damaging	Het
Gm5134	T	A	10: 75,976,346	M145K	possibly damaging	Het
Gm853	A	T	4: 130,211,393	V328D	probably benign	Het
Gnpda1	T	C	18: 38,333,190		probably null	Het
Gpc2	T	C	5: 138,278,379	T162A	probably benign	Het
Gtf2h4	G	A	17: 35,670,198	L246F	possibly damaging	Het
Hal	C	T	10: 93,496,607	P294S	probably damaging	Het
Hectd3	C	T	4: 117,000,343	A573V	possibly damaging	Het
Hephl1	T	A	9: 15,076,818	I665F	probably benign	Het
Herc1	T	C	9: 66,476,126		probably null	Het
Hif1an	A	G	19: 44,571,112		probably null	Het
Il12rb1	T	A	8: 70,813,680	M223K	probably benign	Het
Ilf3	C	T	9: 21,393,714	T201M	probably damaging	Het
Inpp5f	T	C	7: 128,663,969		probably benign	Het
Jcad	T	C	18: 4,674,292	Y685H	probably damaging	Het
Kcnj1	C	A	9: 32,396,738	Q153K	probably benign	Het
Kctd18	A	C	1: 57,959,220	H73Q	probably damaging	Het
Klhl36	T	A	8: 119,876,724	W573R	probably damaging	Het
Lepr	A	G	4: 101,772,836	T583A	probably benign	Het
Ltbp4	G	A	7: 27,337,569		probably benign	Het
Mapt	A	T	11: 104,298,499	E114D	probably benign	Het
Mib1	T	A	18: 10,740,972		probably null	Het
Mthfd1	G	T	12: 76,314,976	A119S	probably damaging	Het
Mylk4	A	T	13: 32,724,853	D90E	probably benign	Het
Nceh1	T	G	3: 27,183,175	L33R	probably damaging	Het
Nfat5	T	C	8: 107,366,236	I91T	probably damaging	Het
Nxn	A	G	11: 76,261,672		probably benign	Het
Oasl1	G	A	5: 114,923,469	A20T	possibly damaging	Het
Olfr1262	T	C	2: 90,002,574	F56S	probably benign	Het
Olfr141	C	T	2: 86,806,827	M57I	probably damaging	Het
Olfr1428	A	G	19: 12,109,507	V13A	probably benign	Het
Olfr1447	A	G	19: 12,900,851	*310Q	probably null	Het
Olfr164	A	T	16: 19,286,302	M147K	probably benign	Het
Olfr791	T	A	10: 129,527,049	V274D	probably damaging	Het
Pepd	T	C	7: 34,971,676	V215A	probably benign	Het
Pfkl	A	T	10: 78,001,426	N104K	probably damaging	Het
Phf24	T	C	4: 42,938,165		probably benign	Het
Pink1	T	C	4: 138,314,020	N530S	probably benign	Het
Pou3f2	T	C	4: 22,487,119	D338G	probably damaging	Het
Ppp1r13b	A	G	12: 111,834,810	V480A	probably damaging	Het
Ptgfrn	A	T	3: 101,056,307	I663N	probably benign	Het
Rad54b	A	C	4: 11,601,693	N416T	probably damaging	Het
Rasef	A	G	4: 73,744,114	S200P	possibly damaging	Het
Rbm33	T	A	5: 28,387,917	I605N	probably damaging	Het
Rps19bp1	T	C	15: 80,264,079	T31A	probably benign	Het
Ryr2	T	A	13: 11,556,698	T4885S	possibly damaging	Het
Serpinb6b	A	G	13: 32,978,240	I222V	probably benign	Het
Sik3	C	G	9: 46,221,089	H1276Q	probably benign	Het
Skor2	T	C	18: 76,859,356	S258P	unknown	Het
Slc22a29	C	T	19: 8,217,759		probably null	Het
Slc8a3	A	T	12: 81,314,844	F400L	probably damaging	Het
Slc9a8	T	C	2: 167,424,214	I37T	possibly damaging	Het
Smchd1	A	G	17: 71,407,237	I877T	possibly damaging	Het
Spag5	A	G	11: 78,304,176	N103S	probably benign	Het
Sptbn1	A	T	11: 30,142,414	F450L	probably damaging	Het
Strn4	T	A	7: 16,833,921	Y507N	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Syt17	G	T	7: 118,433,985	L267I	possibly damaging	Het
Tdo2	T	A	3: 81,958,940	R339W	probably damaging	Het
Ttn	A	G	2: 76,741,401	S26383P	probably damaging	Het
Ttn	G	T	2: 76,808,524	T13938K	probably damaging	Het
Tulp2	A	G	7: 45,517,941	N188D	possibly damaging	Het
Ube3c	C	T	5: 29,587,317	R37C	probably damaging	Het
Uggt2	G	T	14: 119,008,055		probably benign	Het
Umodl1	G	A	17: 30,984,043	V457M	probably damaging	Het
Usp17la	C	T	7: 104,860,746	T186I	probably benign	Het
Vmn1r226	T	C	17: 20,687,580	S25P	probably damaging	Het
Vmn1r235	T	A	17: 21,262,397	I328K	possibly damaging	Het
Vmn2r50	A	T	7: 10,047,683	S378R	probably benign	Het
Vwa2	C	T	19: 56,908,934	T557I	probably benign	Het
Wdr60	A	C	12: 116,232,601	S509A	probably damaging	Het
Yes1	G	T	5: 32,684,735	Q534H	probably benign	Het
Zbtb25	A	T	12: 76,349,301	Y382*	probably null	Het
Zc3h3	G	A	15: 75,777,118	P722S	probably damaging	Het
Zfp36l2	T	C	17: 84,186,736	T158A	probably damaging	Het
Zfp536	T	C	7: 37,480,199	T994A	probably damaging	Het
Zfp592	C	T	7: 81,037,420	Q824*	probably null	Het
Zfp629	C	A	7: 127,612,000	K212N	probably damaging	Het
Zfp930	C	A	8: 69,228,705	Q350K	probably benign	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ACATCCTGTGTGGCGGATAG -3'
(R):5'- GGGCTTCGTAAGTTGATCCCTC -3'

Sequencing Primer
(F):5'- GCGGATAGCCCAAAGCC -3'
(R):5'- CACACCCTTGTCTTTGGAAGTAGAG -3'

Posted On

2014-07-14