Incidental Mutation 'R7072:Lrrk2'
ID 548991
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Name leucine-rich repeat kinase 2
Synonyms 4921513O20Rik, cI-46, D630001M17Rik, 9330188B09Rik, LOC381026
MMRRC Submission 045168-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R7072 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 91557378-91700323 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91686123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2155 (M2155L)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: M2155L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: M2155L

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,967,592 (GRCm39) L2214Q probably damaging Het
Acbd3 T C 1: 180,553,934 (GRCm39) F90L probably benign Het
Ahnak2 T A 12: 112,751,786 (GRCm39) Q23L Het
Anpep A T 7: 79,485,127 (GRCm39) L620I possibly damaging Het
Bpi T C 2: 158,113,998 (GRCm39) S299P probably damaging Het
Bpifa2 A G 2: 153,853,293 (GRCm39) D132G probably damaging Het
Brd7 T A 8: 89,073,615 (GRCm39) E258D probably benign Het
Btc T C 5: 91,550,796 (GRCm39) probably benign Het
Cacna1c A G 6: 118,573,067 (GRCm39) V2039A Het
Calm4 T A 13: 3,888,275 (GRCm39) V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 (GRCm39) S1280T probably damaging Het
Cc2d2b T C 19: 40,748,803 (GRCm39) V80A unknown Het
Ccdc33 A G 9: 58,019,267 (GRCm39) *279R probably null Het
Cercam T A 2: 29,771,936 (GRCm39) H585Q probably benign Het
Cnnm1 A G 19: 43,429,296 (GRCm39) D138G probably benign Het
Cox4i2 T C 2: 152,602,573 (GRCm39) F89S probably damaging Het
Crb1 G A 1: 139,165,013 (GRCm39) T1098I probably damaging Het
Csnk1e C T 15: 79,322,967 (GRCm39) probably null Het
Ctsj C A 13: 61,150,897 (GRCm39) E187* probably null Het
Dagla A T 19: 10,233,659 (GRCm39) probably null Het
Dnah7a G A 1: 53,458,912 (GRCm39) T3742I probably benign Het
Dnajc6 A C 4: 101,472,812 (GRCm39) H381P probably damaging Het
Dyrk3 A T 1: 131,057,465 (GRCm39) L236Q probably damaging Het
Edc4 T A 8: 106,614,634 (GRCm39) D105E probably damaging Het
Frmd5 A T 2: 121,388,351 (GRCm39) L241Q probably damaging Het
Gcc2 A G 10: 58,106,749 (GRCm39) T662A probably benign Het
Gins1 C T 2: 150,751,671 (GRCm39) probably null Het
Gli3 T A 13: 15,900,280 (GRCm39) N1222K possibly damaging Het
Gm4302 G T 10: 100,177,521 (GRCm39) Q268H unknown Het
Grin2d A T 7: 45,506,922 (GRCm39) W518R probably damaging Het
Grm5 A T 7: 87,723,512 (GRCm39) I601F probably damaging Het
Gtpbp10 A T 5: 5,596,365 (GRCm39) N193K probably benign Het
Igdcc4 T G 9: 65,038,013 (GRCm39) V798G probably damaging Het
Igkv8-19 A T 6: 70,318,396 (GRCm39) F13I probably benign Het
Kctd11 T A 11: 69,770,621 (GRCm39) N139I probably benign Het
Lmo7 G A 14: 102,136,136 (GRCm39) probably null Het
Ly6g6g C T 15: 74,644,119 (GRCm39) V66M Het
Mettl24 A C 10: 40,559,509 (GRCm39) H53P probably benign Het
Mier2 A G 10: 79,376,133 (GRCm39) M264T unknown Het
Mplkip T C 13: 17,870,122 (GRCm39) I18T unknown Het
Mtmr2 T C 9: 13,699,916 (GRCm39) V101A probably benign Het
Nbeal2 G T 9: 110,455,119 (GRCm39) T2593K probably benign Het
Neu3 A T 7: 99,463,404 (GRCm39) C106* probably null Het
Nutm1 T C 2: 112,082,192 (GRCm39) T295A probably benign Het
Or2h2b-ps1 A G 17: 37,481,269 (GRCm39) I90T probably benign Het
Pcdhga7 G T 18: 37,850,329 (GRCm39) V779L probably benign Het
Pde10a A G 17: 9,161,858 (GRCm39) E231G probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Plcg2 T A 8: 118,316,574 (GRCm39) probably null Het
Pofut2 T C 10: 77,095,263 (GRCm39) L36P probably benign Het
Pou6f2 T C 13: 18,299,754 (GRCm39) N635S Het
Pramel14 A C 4: 143,720,698 (GRCm39) I81R probably damaging Het
Ptpra T C 2: 130,395,350 (GRCm39) Y818H probably damaging Het
Rad18 T C 6: 112,658,401 (GRCm39) E168G probably benign Het
Rev1 C A 1: 38,106,626 (GRCm39) E634* probably null Het
Sec24d A G 3: 123,124,000 (GRCm39) D403G probably damaging Het
Sema5a C A 15: 32,575,105 (GRCm39) H404Q possibly damaging Het
Shank1 A G 7: 43,994,370 (GRCm39) S844G unknown Het
Slc32a1 T A 2: 158,453,416 (GRCm39) Y85* probably null Het
Slc39a4 T C 15: 76,497,458 (GRCm39) T485A probably damaging Het
Sp5 A C 2: 70,307,074 (GRCm39) Q253P probably benign Het
Sspo A T 6: 48,431,913 (GRCm39) D709V probably damaging Het
Sucnr1 A G 3: 59,993,604 (GRCm39) Y44C probably damaging Het
Taar8b A G 10: 23,967,876 (GRCm39) L106P possibly damaging Het
Tbc1d9 A G 8: 83,991,494 (GRCm39) D922G probably damaging Het
Tbx6 A T 7: 126,383,912 (GRCm39) D322V probably benign Het
Tex15 T A 8: 34,065,459 (GRCm39) S1630T possibly damaging Het
Ube2o G A 11: 116,432,327 (GRCm39) P880S probably benign Het
Uck1 C T 2: 32,148,178 (GRCm39) R182Q probably damaging Het
Utrn T A 10: 12,340,957 (GRCm39) H2840L probably damaging Het
Vps8 A G 16: 21,400,329 (GRCm39) T1266A probably benign Het
Wnk1 A T 6: 119,914,822 (GRCm39) I1909N unknown Het
Zfp352 C T 4: 90,112,661 (GRCm39) T267I probably benign Het
Zfp773 A T 7: 7,135,874 (GRCm39) C241S probably benign Het
Zfp934 T C 13: 62,668,339 (GRCm39) D8G probably damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91,632,002 (GRCm39) missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91,584,146 (GRCm39) missense probably benign
IGL00770:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00774:Lrrk2 APN 15 91,686,036 (GRCm39) splice site probably benign
IGL00791:Lrrk2 APN 15 91,664,044 (GRCm39) missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91,639,993 (GRCm39) missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91,641,261 (GRCm39) missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91,623,035 (GRCm39) missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91,610,340 (GRCm39) missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91,567,345 (GRCm39) missense probably benign
IGL01301:Lrrk2 APN 15 91,651,542 (GRCm39) missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91,584,772 (GRCm39) splice site probably null
IGL01465:Lrrk2 APN 15 91,613,128 (GRCm39) missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91,696,516 (GRCm39) missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91,584,192 (GRCm39) missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91,659,191 (GRCm39) missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91,664,149 (GRCm39) missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91,615,694 (GRCm39) missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91,610,511 (GRCm39) critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91,570,025 (GRCm39) missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91,634,480 (GRCm39) missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91,631,958 (GRCm39) missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91,584,781 (GRCm39) missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91,681,617 (GRCm39) splice site probably null
horned UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
spree UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
Spur UTSW 15 91,659,198 (GRCm39) nonsense probably null
3-1:Lrrk2 UTSW 15 91,686,137 (GRCm39) missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91,651,542 (GRCm39) missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
H8786:Lrrk2 UTSW 15 91,557,561 (GRCm39) missense probably benign
IGL02835:Lrrk2 UTSW 15 91,698,863 (GRCm39) critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0014:Lrrk2 UTSW 15 91,686,248 (GRCm39) splice site probably benign
R0078:Lrrk2 UTSW 15 91,618,212 (GRCm39) missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91,629,999 (GRCm39) missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91,662,617 (GRCm39) splice site probably benign
R0448:Lrrk2 UTSW 15 91,593,508 (GRCm39) missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91,634,478 (GRCm39) missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91,699,619 (GRCm39) missense probably benign
R0617:Lrrk2 UTSW 15 91,636,481 (GRCm39) missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91,680,231 (GRCm39) missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91,657,199 (GRCm39) missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91,641,273 (GRCm39) critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91,659,249 (GRCm39) splice site probably null
R0766:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91,640,165 (GRCm39) missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91,613,284 (GRCm39) missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91,613,372 (GRCm39) missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91,557,892 (GRCm39) missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91,584,671 (GRCm39) nonsense probably null
R1223:Lrrk2 UTSW 15 91,557,838 (GRCm39) missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91,696,563 (GRCm39) missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91,613,123 (GRCm39) missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91,618,261 (GRCm39) missense probably benign
R1773:Lrrk2 UTSW 15 91,664,184 (GRCm39) missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91,584,095 (GRCm39) missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91,567,337 (GRCm39) missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91,620,864 (GRCm39) splice site probably null
R2160:Lrrk2 UTSW 15 91,680,263 (GRCm39) missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91,648,919 (GRCm39) missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91,681,729 (GRCm39) splice site probably benign
R2516:Lrrk2 UTSW 15 91,640,130 (GRCm39) missense probably benign
R3110:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91,698,898 (GRCm39) missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91,621,314 (GRCm39) missense probably benign
R3842:Lrrk2 UTSW 15 91,640,119 (GRCm39) missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91,631,904 (GRCm39) missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91,631,903 (GRCm39) missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91,651,664 (GRCm39) critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,662,707 (GRCm39) missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91,596,983 (GRCm39) missense possibly damaging 0.69
R3982:Lrrk2 UTSW 15 91,593,487 (GRCm39) missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91,699,686 (GRCm39) missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91,639,997 (GRCm39) missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91,584,098 (GRCm39) missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91,632,023 (GRCm39) missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91,607,391 (GRCm39) missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91,589,323 (GRCm39) missense probably benign
R4539:Lrrk2 UTSW 15 91,613,345 (GRCm39) missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91,584,130 (GRCm39) missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91,573,104 (GRCm39) missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91,648,962 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,649,950 (GRCm39) missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91,573,052 (GRCm39) missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91,597,031 (GRCm39) missense probably benign
R4945:Lrrk2 UTSW 15 91,689,123 (GRCm39) missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91,687,592 (GRCm39) missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91,634,081 (GRCm39) missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91,584,822 (GRCm39) missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91,649,993 (GRCm39) missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91,680,292 (GRCm39) missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91,698,847 (GRCm39) splice site probably null
R5551:Lrrk2 UTSW 15 91,696,553 (GRCm39) missense probably benign
R5574:Lrrk2 UTSW 15 91,671,219 (GRCm39) missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91,649,948 (GRCm39) missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91,687,504 (GRCm39) nonsense probably null
R5712:Lrrk2 UTSW 15 91,586,425 (GRCm39) nonsense probably null
R5728:Lrrk2 UTSW 15 91,659,177 (GRCm39) missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91,586,386 (GRCm39) missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91,648,851 (GRCm39) missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91,593,593 (GRCm39) critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91,640,152 (GRCm39) missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91,618,249 (GRCm39) missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91,630,034 (GRCm39) missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91,657,148 (GRCm39) missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91,607,338 (GRCm39) missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91,632,029 (GRCm39) missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91,586,450 (GRCm39) missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91,626,469 (GRCm39) missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91,696,549 (GRCm39) missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91,607,421 (GRCm39) missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91,659,198 (GRCm39) nonsense probably null
R7109:Lrrk2 UTSW 15 91,648,985 (GRCm39) missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91,686,088 (GRCm39) missense probably benign
R7144:Lrrk2 UTSW 15 91,618,258 (GRCm39) missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91,641,204 (GRCm39) missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91,584,644 (GRCm39) missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91,622,947 (GRCm39) missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91,615,858 (GRCm39) critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91,584,207 (GRCm39) critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91,651,543 (GRCm39) missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91,696,528 (GRCm39) missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91,657,061 (GRCm39) missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91,696,526 (GRCm39) missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91,584,561 (GRCm39) missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91,610,389 (GRCm39) missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91,699,649 (GRCm39) missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91,584,816 (GRCm39) missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91,651,527 (GRCm39) missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91,610,355 (GRCm39) missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91,557,443 (GRCm39) start gained probably benign
R8389:Lrrk2 UTSW 15 91,584,194 (GRCm39) missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91,615,680 (GRCm39) missense probably benign
R8698:Lrrk2 UTSW 15 91,636,400 (GRCm39) missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91,586,473 (GRCm39) nonsense probably null
R9084:Lrrk2 UTSW 15 91,634,469 (GRCm39) missense
R9086:Lrrk2 UTSW 15 91,640,051 (GRCm39) missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9097:Lrrk2 UTSW 15 91,557,459 (GRCm39) start gained probably benign
R9267:Lrrk2 UTSW 15 91,584,629 (GRCm39) missense probably damaging 0.99
R9285:Lrrk2 UTSW 15 91,662,686 (GRCm39) missense probably damaging 1.00
R9341:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9343:Lrrk2 UTSW 15 91,584,618 (GRCm39) missense probably benign 0.18
R9371:Lrrk2 UTSW 15 91,607,407 (GRCm39) missense probably damaging 1.00
R9424:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9489:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9502:Lrrk2 UTSW 15 91,607,365 (GRCm39) missense probably damaging 0.98
R9563:Lrrk2 UTSW 15 91,634,043 (GRCm39) missense possibly damaging 0.90
R9576:Lrrk2 UTSW 15 91,636,388 (GRCm39) nonsense probably null
R9605:Lrrk2 UTSW 15 91,621,420 (GRCm39) missense probably benign 0.37
R9635:Lrrk2 UTSW 15 91,696,527 (GRCm39) missense probably benign 0.21
R9641:Lrrk2 UTSW 15 91,671,251 (GRCm39) missense possibly damaging 0.94
R9660:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9673:Lrrk2 UTSW 15 91,649,884 (GRCm39) missense probably damaging 1.00
R9708:Lrrk2 UTSW 15 91,634,482 (GRCm39) nonsense probably null
R9728:Lrrk2 UTSW 15 91,618,228 (GRCm39) missense probably benign 0.00
R9757:Lrrk2 UTSW 15 91,695,229 (GRCm39) missense probably benign 0.03
RF001:Lrrk2 UTSW 15 91,620,836 (GRCm39) missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91,623,054 (GRCm39) missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91,610,443 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCTTAACTGAGAACTGTAGGTTTTC -3'
(R):5'- CAGCCACTTACTTGTTCTAAAGG -3'

Sequencing Primer
(F):5'- CAGCTTTAGGACACATTTGATC -3'
(R):5'- GGCTCTTATTTGATTTCCTCCAAAG -3'
Posted On 2019-05-15