Mutagenetix > Incidental Mutation

Incidental Mutation 'H8562:Lrrk2'

44392

Institutional Source

Beutler Lab

Gene Symbol

Lrrk2

Ensembl Gene

ENSMUSG00000036273

Gene Name

leucine-rich repeat kinase 2

Synonyms

9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik

Accession Numbers

Genbank: NM_025730; MGI: 1913975

Essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

H8562 (G3) of strain 604

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91673175-91816120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91673358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 26 (N26K)

Ref Sequence

ENSEMBL: ENSMUSP00000052584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060642]

AlphaFold

Q5S006

Predicted Effect

probably benign
Transcript: ENSMUST00000060642
AA Change: N26K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: N26K

Domain	Start	End	E-Value	Type
low complexity region	138	156	N/A	INTRINSIC
low complexity region	332	347	N/A	INTRINSIC
ANK	708	737	3.95e1	SMART
ANK	770	800	4.58e2	SMART
low complexity region	890	901	N/A	INTRINSIC
low complexity region	953	966	N/A	INTRINSIC
low complexity region	971	979	N/A	INTRINSIC
LRR	1010	1033	9.96e-1	SMART
LRR	1034	1057	8.01e0	SMART
LRR	1082	1105	2.45e0	SMART
LRR	1128	1151	9.3e-1	SMART
LRR	1195	1219	3.24e0	SMART
LRR	1244	1266	3.87e1	SMART
LRR	1267	1291	4.98e1	SMART
Pfam:Roc	1336	1456	4.9e-32	PFAM
Pfam:Ras	1336	1489	3.3e-17	PFAM
Pfam:COR	1524	1740	4e-28	PFAM
Pfam:Pkinase	1881	2132	4.7e-40	PFAM
Pfam:Pkinase_Tyr	1882	2132	6.8e-39	PFAM
WD40	2231	2276	3.09e-1	SMART
WD40	2401	2438	1.37e2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

96% (109/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	A	G	19: 7,422,921	K251E	probably benign	Het
2810021J22Rik	T	C	11: 58,880,891	C400R	probably damaging	Het
4930519F16Rik	A	T	X: 103,255,857		noncoding transcript	Het
5430402E10Rik	G	T	X: 77,922,734	H117Q	probably damaging	Het
Abca15	T	C	7: 120,374,854		probably benign	Het
Abca8a	A	G	11: 110,043,009	I1190T	probably benign	Het
Acmsd	T	C	1: 127,749,058	Y107H	probably benign	Het
Adcy5	A	G	16: 35,267,181	I471V	probably damaging	Het
Aff2	G	A	X: 69,848,926	A939T	unknown	Het
Ampd2	C	A	3: 108,081,111	A11S	probably benign	Het
Aoah	T	A	13: 20,816,524	C43S	probably damaging	Het
Apobec4	T	C	1: 152,757,174	S318P	probably damaging	Het
Arid2	C	T	15: 96,369,546	P636S	possibly damaging	Het
Atp13a3	A	T	16: 30,359,725	C164*	probably null	Het
Avl9	G	A	6: 56,757,310	A625T	probably damaging	Het
Bco1	G	T	8: 117,105,647		probably benign	Het
Brd3	C	T	2: 27,450,533	G555S	possibly damaging	Het
Brd4	A	T	17: 32,229,403		probably benign	Het
Btbd7	A	G	12: 102,788,302	V735A	probably benign	Het
C2cd2	G	T	16: 97,879,640	Q325K	possibly damaging	Het
Carmil1	A	G	13: 24,064,647	V485A	probably benign	Het
Casz1	T	C	4: 148,933,451	L113P	probably damaging	Het
Ccdc3	T	C	2: 5,138,205	L91S	probably damaging	Het
Cd180	A	G	13: 102,705,418	K324R	probably benign	Het
Cd200r4	A	G	16: 44,833,373	T132A	possibly damaging	Het
Cops7a	A	G	6: 124,962,453		probably benign	Het
Cyp2c29	A	T	19: 39,309,662	N217I	probably damaging	Het
Dapk1	C	A	13: 60,761,312	H1246Q	probably damaging	Het
Dmbt1	T	A	7: 131,112,076	C1450*	probably null	Het
Dnah10	T	A	5: 124,829,529	M4151K	probably damaging	Het
Dnaic1	C	A	4: 41,629,833	F452L	possibly damaging	Het
Dync1h1	T	C	12: 110,616,807	M446T	probably benign	Het
Dytn	A	C	1: 63,674,912	S143A	possibly damaging	Het
E130308A19Rik	T	A	4: 59,691,033	L289Q	possibly damaging	Het
Efemp2	G	T	19: 5,480,649	V250L	probably benign	Het
Elmo1	T	C	13: 20,280,863	S201P	probably damaging	Het
Fam208b	A	T	13: 3,577,000	S983R	probably damaging	Het
Fam222b	T	A	11: 78,154,578	C194S	probably damaging	Het
Fam91a1	G	A	15: 58,427,121		probably null	Het
Fcf1	T	A	12: 84,980,612		probably benign	Het
Fnip1	T	A	11: 54,480,297	F134L	probably damaging	Het
Fyn	T	C	10: 39,511,954	S69P	probably benign	Het
Gabbr1	T	C	17: 37,071,949	Y845H	probably damaging	Het
Gfra2	C	T	14: 70,978,378	T169M	possibly damaging	Het
Gm13083	T	A	4: 143,615,350		probably benign	Het
Gm1966	A	G	7: 106,603,149	F296S	probably damaging	Het
Gm5435	T	C	12: 82,495,675		noncoding transcript	Het
Gm7251	A	G	13: 49,805,672	Y94H	probably damaging	Het
Heatr1	T	A	13: 12,408,713	N530K	probably benign	Het
Hist1h2bn	T	C	13: 21,754,478	V119A	probably benign	Het
Icam5	A	T	9: 21,035,146	E355V	probably benign	Het
Ighv3-6	A	G	12: 114,288,538		probably benign	Het
Intu	T	C	3: 40,692,673	S659P	probably damaging	Het
Ivns1abp	T	C	1: 151,354,695	V198A	probably damaging	Het
Katnb1	T	A	8: 95,095,510		probably benign	Het
Kcna5	T	C	6: 126,533,423	S581G	probably damaging	Het
Kif23	A	G	9: 61,924,065	V741A	probably benign	Het
Lbr	A	T	1: 181,820,668		probably benign	Het
Loxhd1	A	C	18: 77,341,931	T508P	possibly damaging	Het
Ly96	A	T	1: 16,691,694	K41N	probably damaging	Het
Lypd1	C	T	1: 125,910,537		probably benign	Het
Macf1	A	G	4: 123,466,040	V1817A	probably benign	Het
Mknk2	A	G	10: 80,668,934		probably benign	Het
Mmp19	A	T	10: 128,795,601	I117L	probably benign	Het
Mmrn1	G	A	6: 60,958,180	G220D	probably damaging	Het
Mtrr	T	C	13: 68,564,377	H630R	probably damaging	Het
Nfat5	T	C	8: 107,339,382		probably benign	Het
Ngef	C	A	1: 87,487,807	K288N	possibly damaging	Het
Nkain4	T	C	2: 180,943,145	E71G	probably benign	Het
Odc1	T	C	12: 17,548,037	Y122H	probably benign	Het
Olfr384	T	C	11: 73,603,447	I289T	probably damaging	Het
Olfr715	C	A	7: 107,129,241	A51S	probably benign	Het
Olfr919	C	A	9: 38,697,910	G156V	probably damaging	Het
Osbpl3	A	T	6: 50,347,466	N190K	probably benign	Het
Osgepl1	T	C	1: 53,315,039	V54A	probably damaging	Het
Otogl	T	C	10: 107,910,956	Y19C	probably benign	Het
Pop1	T	C	15: 34,530,212	S919P	probably benign	Het
Prl8a9	A	G	13: 27,562,601		probably benign	Het
Prr14l	A	T	5: 32,793,728	V1907D	probably damaging	Het
Ptprn	T	C	1: 75,254,620	T547A	possibly damaging	Het
Rdh14	G	T	12: 10,394,709	V187F	probably damaging	Het
Rev1	A	G	1: 38,056,767	L853P	probably damaging	Het
Robo4	T	C	9: 37,405,810		probably benign	Het
Ryr2	A	G	13: 11,717,141		probably benign	Het
Sec16a	G	A	2: 26,441,505	P166L	probably benign	Het
Slc6a19	G	A	13: 73,700,124		probably benign	Het
Slco4c1	T	A	1: 96,842,485	T285S	probably benign	Het
Speg	G	T	1: 75,415,597	A1633S	probably benign	Het
Srpk1	T	A	17: 28,602,733	T236S	probably benign	Het
Stxbp5	T	C	10: 9,769,443	N262S	probably benign	Het
Suco	T	C	1: 161,852,851	E317G	probably damaging	Het
Syk	A	G	13: 52,640,621	N441D	probably damaging	Het
Syt17	T	C	7: 118,408,069	K334R	probably benign	Het
Sytl5	A	T	X: 9,960,096	H436L	probably benign	Het
Thada	A	G	17: 84,446,544	L333P	probably damaging	Het
Thap12	T	C	7: 98,715,107	Y161H	probably damaging	Het
Thbs2	C	T	17: 14,671,453	V941I	probably benign	Het
Tktl1	A	T	X: 74,181,864	E72V	probably damaging	Het
Tm4sf5	T	A	11: 70,505,512		probably benign	Het
Urb1	T	A	16: 90,769,469	M1477L	probably benign	Het
Vcp	T	A	4: 42,982,596	I699F	probably damaging	Het
Vmn1r232	T	C	17: 20,913,394	T315A	probably benign	Het
Vmn2r100	T	A	17: 19,521,490	W155R	possibly damaging	Het
Vmn2r19	T	C	6: 123,315,902	I301T	possibly damaging	Het
Wwc2	A	G	8: 47,920,666	V55A	possibly damaging	Het
Xirp2	A	G	2: 67,515,457	T2681A	probably benign	Het
Zfp39	C	A	11: 58,900,686	L58F	probably damaging	Het
Zfp612	T	C	8: 110,090,038	F587L	probably damaging	Het
Zfp810	T	C	9: 22,279,091	R174G	probably benign	Het

Other mutations in Lrrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Lrrk2	APN	15	91747799	missense	possibly damaging	0.90
IGL00542:Lrrk2	APN	15	91699943	missense	probably benign
IGL00770:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00774:Lrrk2	APN	15	91801833	splice site	probably benign
IGL00791:Lrrk2	APN	15	91779841	missense	probably damaging	1.00
IGL00827:Lrrk2	APN	15	91755790	missense	probably damaging	1.00
IGL00843:Lrrk2	APN	15	91757058	missense	possibly damaging	0.58
IGL01109:Lrrk2	APN	15	91738832	missense	probably damaging	1.00
IGL01293:Lrrk2	APN	15	91726137	missense	probably benign	0.21
IGL01296:Lrrk2	APN	15	91683142	missense	probably benign
IGL01301:Lrrk2	APN	15	91767339	missense	probably damaging	1.00
IGL01360:Lrrk2	APN	15	91700569	splice site	probably null
IGL01465:Lrrk2	APN	15	91728925	missense	probably benign	0.21
IGL01529:Lrrk2	APN	15	91812313	missense	possibly damaging	0.92
IGL01557:Lrrk2	APN	15	91699989	missense	probably damaging	1.00
IGL01560:Lrrk2	APN	15	91774988	missense	probably benign	0.33
IGL01991:Lrrk2	APN	15	91779946	missense	probably damaging	0.99
IGL02003:Lrrk2	APN	15	91731491	missense	probably damaging	0.99
IGL02325:Lrrk2	APN	15	91726308	critical splice donor site	probably null
IGL02711:Lrrk2	APN	15	91685822	missense	possibly damaging	0.71
IGL02869:Lrrk2	APN	15	91750277	missense	probably damaging	1.00
IGL03104:Lrrk2	APN	15	91747755	missense	possibly damaging	0.68
IGL03179:Lrrk2	APN	15	91700578	missense	probably damaging	1.00
IGL03395:Lrrk2	APN	15	91797414	splice site	probably null
horned	UTSW	15	91772858	missense	probably damaging	1.00
R1312_Lrrk2_980	UTSW	15	91699895	missense	probably damaging	1.00
R4710_lrrk2_232	UTSW	15	91699927	missense	possibly damaging	0.88
R5245_Lrrk2_127	UTSW	15	91796089	missense	probably damaging	1.00
spree	UTSW	15	91702247	missense	probably benign	0.00
Spur	UTSW	15	91774995	nonsense	probably null
3-1:Lrrk2	UTSW	15	91801934	missense	probably benign	0.01
ANU18:Lrrk2	UTSW	15	91767339	missense	probably damaging	1.00
H8786:Lrrk2	UTSW	15	91673358	missense	probably benign
IGL02835:Lrrk2	UTSW	15	91814660	critical splice acceptor site	probably null
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0014:Lrrk2	UTSW	15	91802045	splice site	probably benign
R0078:Lrrk2	UTSW	15	91734009	missense	probably benign	0.01
R0100:Lrrk2	UTSW	15	91745796	missense	probably damaging	1.00
R0282:Lrrk2	UTSW	15	91778414	splice site	probably benign
R0448:Lrrk2	UTSW	15	91709305	missense	probably damaging	0.99
R0449:Lrrk2	UTSW	15	91750275	missense	probably damaging	1.00
R0610:Lrrk2	UTSW	15	91815416	missense	probably benign
R0617:Lrrk2	UTSW	15	91752278	missense	probably benign	0.00
R0632:Lrrk2	UTSW	15	91796028	missense	probably damaging	0.98
R0639:Lrrk2	UTSW	15	91772996	missense	probably benign	0.03
R0661:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R0666:Lrrk2	UTSW	15	91757070	critical splice donor site	probably null
R0764:Lrrk2	UTSW	15	91775046	splice site	probably null
R0766:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R0845:Lrrk2	UTSW	15	91755962	missense	probably benign	0.22
R0940:Lrrk2	UTSW	15	91729081	missense	possibly damaging	0.83
R0970:Lrrk2	UTSW	15	91729169	missense	probably benign	0.22
R1080:Lrrk2	UTSW	15	91673689	missense	probably benign	0.01
R1114:Lrrk2	UTSW	15	91700468	nonsense	probably null
R1223:Lrrk2	UTSW	15	91673635	missense	probably benign	0.00
R1289:Lrrk2	UTSW	15	91812360	missense	probably benign	0.00
R1296:Lrrk2	UTSW	15	91728920	missense	probably damaging	1.00
R1312:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R1637:Lrrk2	UTSW	15	91734058	missense	probably benign
R1773:Lrrk2	UTSW	15	91779981	missense	possibly damaging	0.96
R1809:Lrrk2	UTSW	15	91699892	missense	possibly damaging	0.86
R1839:Lrrk2	UTSW	15	91683134	missense	probably benign	0.00
R1946:Lrrk2	UTSW	15	91736661	splice site	probably null
R2160:Lrrk2	UTSW	15	91796060	missense	probably damaging	1.00
R2232:Lrrk2	UTSW	15	91764716	missense	probably benign	0.05
R2419:Lrrk2	UTSW	15	91797526	splice site	probably benign
R2516:Lrrk2	UTSW	15	91755927	missense	probably benign
R3110:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3112:Lrrk2	UTSW	15	91814695	missense	probably benign	0.02
R3801:Lrrk2	UTSW	15	91737111	missense	probably benign
R3842:Lrrk2	UTSW	15	91755916	missense	probably benign	0.01
R3903:Lrrk2	UTSW	15	91747700	missense	probably damaging	1.00
R3903:Lrrk2	UTSW	15	91747701	missense	probably damaging	1.00
R3930:Lrrk2	UTSW	15	91767461	critical splice donor site	probably null
R3937:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91712780	missense	possibly damaging	0.69
R3938:Lrrk2	UTSW	15	91778504	missense	probably damaging	0.98
R3982:Lrrk2	UTSW	15	91709284	missense	probably benign	0.22
R4125:Lrrk2	UTSW	15	91815483	missense	probably benign	0.01
R4130:Lrrk2	UTSW	15	91755794	missense	probably benign	0.19
R4296:Lrrk2	UTSW	15	91699895	missense	probably damaging	1.00
R4465:Lrrk2	UTSW	15	91747820	missense	probably damaging	0.96
R4478:Lrrk2	UTSW	15	91723188	missense	probably damaging	1.00
R4517:Lrrk2	UTSW	15	91705120	missense	probably benign
R4539:Lrrk2	UTSW	15	91729142	missense	possibly damaging	0.86
R4654:Lrrk2	UTSW	15	91765681	missense	probably damaging	0.96
R4710:Lrrk2	UTSW	15	91699927	missense	possibly damaging	0.88
R4722:Lrrk2	UTSW	15	91688901	missense	probably damaging	1.00
R4723:Lrrk2	UTSW	15	91764759	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91688849	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91688849	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91765747	missense	probably damaging	1.00
R4787:Lrrk2	UTSW	15	91712828	missense	probably benign
R4945:Lrrk2	UTSW	15	91804920	missense	probably benign	0.02
R4948:Lrrk2	UTSW	15	91803389	missense	probably benign	0.20
R5000:Lrrk2	UTSW	15	91749878	missense	probably damaging	1.00
R5031:Lrrk2	UTSW	15	91700619	missense	possibly damaging	0.50
R5067:Lrrk2	UTSW	15	91765790	missense	probably benign	0.01
R5245:Lrrk2	UTSW	15	91796089	missense	probably damaging	1.00
R5341:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R5460:Lrrk2	UTSW	15	91814644	splice site	probably null
R5551:Lrrk2	UTSW	15	91812350	missense	probably benign
R5574:Lrrk2	UTSW	15	91787016	missense	probably damaging	1.00
R5577:Lrrk2	UTSW	15	91765745	missense	probably damaging	1.00
R5685:Lrrk2	UTSW	15	91803301	nonsense	probably null
R5712:Lrrk2	UTSW	15	91702222	nonsense	probably null
R5728:Lrrk2	UTSW	15	91774974	missense	probably benign	0.36
R5782:Lrrk2	UTSW	15	91702183	missense	probably damaging	1.00
R5788:Lrrk2	UTSW	15	91764648	missense	possibly damaging	0.55
R5821:Lrrk2	UTSW	15	91709390	critical splice donor site	probably null
R5852:Lrrk2	UTSW	15	91755949	missense	probably damaging	1.00
R5934:Lrrk2	UTSW	15	91734046	missense	probably benign	0.00
R5935:Lrrk2	UTSW	15	91745831	missense	probably benign	0.14
R5979:Lrrk2	UTSW	15	91772945	missense	possibly damaging	0.47
R6101:Lrrk2	UTSW	15	91723135	missense	probably benign	0.10
R6114:Lrrk2	UTSW	15	91747826	missense	probably benign	0.33
R6259:Lrrk2	UTSW	15	91702247	missense	probably benign	0.00
R6376:Lrrk2	UTSW	15	91742266	missense	possibly damaging	0.89
R6417:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6420:Lrrk2	UTSW	15	91812346	missense	probably benign	0.03
R6737:Lrrk2	UTSW	15	91723218	missense	possibly damaging	0.50
R7056:Lrrk2	UTSW	15	91774995	nonsense	probably null
R7072:Lrrk2	UTSW	15	91801920	missense	probably benign	0.03
R7109:Lrrk2	UTSW	15	91764782	missense	probably damaging	1.00
R7128:Lrrk2	UTSW	15	91801885	missense	probably benign
R7144:Lrrk2	UTSW	15	91734055	missense	possibly damaging	0.54
R7187:Lrrk2	UTSW	15	91757001	missense	possibly damaging	0.92
R7270:Lrrk2	UTSW	15	91700441	missense	probably benign	0.01
R7356:Lrrk2	UTSW	15	91738744	missense	probably benign	0.07
R7360:Lrrk2	UTSW	15	91731655	critical splice donor site	probably null
R7373:Lrrk2	UTSW	15	91700004	critical splice donor site	probably null
R7465:Lrrk2	UTSW	15	91767340	missense	probably damaging	1.00
R7477:Lrrk2	UTSW	15	91812325	missense	probably damaging	0.98
R7614:Lrrk2	UTSW	15	91772858	missense	probably damaging	1.00
R7622:Lrrk2	UTSW	15	91812323	missense	probably damaging	1.00
R7658:Lrrk2	UTSW	15	91700358	missense	possibly damaging	0.91
R7679:Lrrk2	UTSW	15	91726186	missense	possibly damaging	0.58
R7737:Lrrk2	UTSW	15	91815446	missense	probably damaging	0.98
R7739:Lrrk2	UTSW	15	91700613	missense	probably damaging	1.00
R7740:Lrrk2	UTSW	15	91767324	missense	probably damaging	1.00
R7908:Lrrk2	UTSW	15	91726152	missense	probably damaging	1.00
R8299:Lrrk2	UTSW	15	91673240	start gained	probably benign
R8389:Lrrk2	UTSW	15	91699991	missense	probably damaging	1.00
R8462:Lrrk2	UTSW	15	91731477	missense	probably benign
R8698:Lrrk2	UTSW	15	91752197	missense	probably benign	0.38
R8947:Lrrk2	UTSW	15	91702270	nonsense	probably null
R9084:Lrrk2	UTSW	15	91750266	missense
R9086:Lrrk2	UTSW	15	91755848	missense	probably benign	0.01
R9096:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9097:Lrrk2	UTSW	15	91673256	start gained	probably benign
R9267:Lrrk2	UTSW	15	91700426	missense	probably damaging	0.99
R9285:Lrrk2	UTSW	15	91778483	missense	probably damaging	1.00
R9341:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9343:Lrrk2	UTSW	15	91700415	missense	probably benign	0.18
R9371:Lrrk2	UTSW	15	91723204	missense	probably damaging	1.00
R9424:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9489:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9502:Lrrk2	UTSW	15	91723162	missense	probably damaging	0.98
R9563:Lrrk2	UTSW	15	91749840	missense	possibly damaging	0.90
R9576:Lrrk2	UTSW	15	91752185	nonsense	probably null
R9605:Lrrk2	UTSW	15	91737217	missense	probably benign	0.37
R9635:Lrrk2	UTSW	15	91812324	missense	probably benign	0.21
R9641:Lrrk2	UTSW	15	91787048	missense	possibly damaging	0.94
R9660:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9673:Lrrk2	UTSW	15	91765681	missense	probably damaging	1.00
R9708:Lrrk2	UTSW	15	91750279	nonsense	probably null
R9728:Lrrk2	UTSW	15	91734025	missense	probably benign	0.00
R9757:Lrrk2	UTSW	15	91811026	missense	probably benign	0.03
RF001:Lrrk2	UTSW	15	91736633	missense	probably benign	0.11
X0028:Lrrk2	UTSW	15	91738851	missense	probably benign	0.00
Z1088:Lrrk2	UTSW	15	91726240	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- AGCCCATGTAGCTGGCCGATTTTG -3'
(R):5'- ACCTGCTGTACACTGGCAACTCTC -3'

Sequencing Primer
(F):5'- TTTCCTGAAAGGGGCCAACTG -3'
(R):5'- ACTGGCAACTCTCATGTAGG -3'

Posted On

2013-06-11