Incidental Mutation 'PIT4585001:Lpp'
ID556630
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24761947 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 263 (C263R)
Ref Sequence ENSEMBL: ENSMUSP00000036304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314]
Predicted Effect probably benign
Transcript: ENSMUST00000038053
AA Change: C263R

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: C263R

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078988
AA Change: C263R

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: C263R

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115314
AA Change: C138R

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: C138R

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
LIM 291 344 1.03e-16 SMART
LIM 351 403 1.94e-12 SMART
LIM 411 472 2.5e-15 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R0798:Lpp UTSW 16 24971872 nonsense probably null
R1199:Lpp UTSW 16 24681860 missense probably damaging 1.00
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4712:Lpp UTSW 16 24761657 missense possibly damaging 0.94
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5371:Lpp UTSW 16 24889804 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R5875:Lpp UTSW 16 24608309 missense probably benign 0.10
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
R7846:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
R7929:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- CCATCCCAGTGACTCCAATTG -3'
(R):5'- GGTTGAACCTGTTGCCCATAAG -3'

Sequencing Primer
(F):5'- CAGTGACTCCAATTGGAACAC -3'
(R):5'- TGTTGCCCATAAGCAGTATCAC -3'
Posted On2019-06-07