Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4585001:Lpp'

556630

Institutional Source

Beutler Lab

Gene Symbol

Lpp

Ensembl Gene

ENSMUSG00000033306

Gene Name

LIM domain containing preferred translocation partner in lipoma

Synonyms

B130055L10Rik, 9430020K16Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24393507-24992578 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24761947 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 263 (C263R)

Ref Sequence

ENSEMBL: ENSMUSP00000036304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314]

Predicted Effect

probably benign
Transcript: ENSMUST00000038053
AA Change: C263R

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: C263R

Domain	Start	End	E-Value	Type
low complexity region	41	55	N/A	INTRINSIC
low complexity region	61	93	N/A	INTRINSIC
coiled coil region	109	134	N/A	INTRINSIC
low complexity region	174	197	N/A	INTRINSIC
low complexity region	255	267	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC
LIM	416	469	1.03e-16	SMART
LIM	476	528	1.94e-12	SMART
LIM	536	597	2.5e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078988
AA Change: C263R

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: C263R

Domain	Start	End	E-Value	Type
low complexity region	41	55	N/A	INTRINSIC
low complexity region	61	93	N/A	INTRINSIC
coiled coil region	109	134	N/A	INTRINSIC
low complexity region	174	197	N/A	INTRINSIC
low complexity region	255	267	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC
LIM	416	469	1.03e-16	SMART
LIM	476	528	1.94e-12	SMART
LIM	536	597	2.5e-15	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115314
AA Change: C138R

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: C138R

Domain	Start	End	E-Value	Type
low complexity region	49	72	N/A	INTRINSIC
low complexity region	130	142	N/A	INTRINSIC
low complexity region	246	261	N/A	INTRINSIC
LIM	291	344	1.03e-16	SMART
LIM	351	403	1.94e-12	SMART
LIM	411	472	2.5e-15	SMART

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Lpp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Lpp	APN	16	24845188	missense	probably damaging	1.00
IGL01354:Lpp	APN	16	24762066	nonsense	probably null
IGL02141:Lpp	APN	16	24761615	missense	probably damaging	0.98
IGL02182:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02230:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02232:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02234:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02236:Lpp	APN	16	24762145	missense	probably damaging	0.99
IGL02371:Lpp	APN	16	24761611	missense	probably damaging	0.96
IGL03265:Lpp	APN	16	24761987	missense	probably damaging	1.00
R0047:Lpp	UTSW	16	24661800	splice site	probably benign
R0047:Lpp	UTSW	16	24661800	splice site	probably benign
R0092:Lpp	UTSW	16	24761602	missense	probably benign	0.01
R0385:Lpp	UTSW	16	24761837	missense	probably damaging	1.00
R0389:Lpp	UTSW	16	24608241	missense	probably damaging	1.00
R0504:Lpp	UTSW	16	24971970	missense	probably damaging	1.00
R0798:Lpp	UTSW	16	24971872	nonsense	probably null
R1199:Lpp	UTSW	16	24681860	missense	probably damaging	1.00
R1581:Lpp	UTSW	16	24681841	nonsense	probably null
R1755:Lpp	UTSW	16	24845124	missense	probably benign
R1848:Lpp	UTSW	16	24761655	missense	probably damaging	1.00
R1980:Lpp	UTSW	16	24661701	missense	probably damaging	1.00
R3432:Lpp	UTSW	16	24889886	missense	probably benign	0.04
R3755:Lpp	UTSW	16	24845161	missense	probably benign	0.00
R4078:Lpp	UTSW	16	24681861	missense	probably damaging	1.00
R4214:Lpp	UTSW	16	24762054	nonsense	probably null
R4712:Lpp	UTSW	16	24761657	missense	possibly damaging	0.94
R4806:Lpp	UTSW	16	24661680	missense	probably damaging	0.97
R4968:Lpp	UTSW	16	24979314	missense	probably damaging	1.00
R5047:Lpp	UTSW	16	24971846	missense	probably damaging	1.00
R5371:Lpp	UTSW	16	24889804	missense	probably damaging	1.00
R5536:Lpp	UTSW	16	24845206	missense	possibly damaging	0.54
R5875:Lpp	UTSW	16	24608309	missense	probably benign	0.10
R7285:Lpp	UTSW	16	24977279	missense	probably damaging	1.00
R7846:Lpp	UTSW	16	24608126	start codon destroyed	probably null	0.98
R7929:Lpp	UTSW	16	24608126	start codon destroyed	probably null	0.98

Predicted Primers

PCR Primer
(F):5'- CCATCCCAGTGACTCCAATTG -3'
(R):5'- GGTTGAACCTGTTGCCCATAAG -3'

Sequencing Primer
(F):5'- CAGTGACTCCAATTGGAACAC -3'
(R):5'- TGTTGCCCATAAGCAGTATCAC -3'

Posted On

2019-06-07