Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4585001:Cse1l'

556587

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 166941474 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 783 (T783A)

Ref Sequence

ENSEMBL: ENSMUSP00000002790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002790
AA Change: T783A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: T783A

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163437
AA Change: T470A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: T470A

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164974

SMART Domains

Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:CAS_CSE1	24	72	5.4e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168599
AA Change: T727A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: T727A

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7683:Cse1l	UTSW	2	166922788	missense	probably benign
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973

Predicted Primers

PCR Primer
(F):5'- AACACATGCCTCCGTGAGTC -3'
(R):5'- CAGACTTTGGAAGAGAATGCCCC -3'

Sequencing Primer
(F):5'- ATGCCTCCGTGAGTCCCATTAAC -3'
(R):5'- CTGGAACTCACTTTGTAGCCAGG -3'

Posted On

2019-06-07