Incidental Mutation 'PIT4585001:Dnajc16'
ID 556592
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # PIT4585001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141491996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 609 (Y609C)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000038014
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: Y609C

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,199,117 (GRCm39) M318V probably benign Het
Cacna2d1 T A 5: 16,531,342 (GRCm39) D560E probably damaging Het
Ccdc148 T A 2: 58,872,988 (GRCm39) T202S probably benign Het
Cdc42bpb T C 12: 111,271,412 (GRCm39) D1149G probably damaging Het
Clasp1 T A 1: 118,390,285 (GRCm39) N156K probably damaging Het
Cox18 G A 5: 90,365,434 (GRCm39) T255I possibly damaging Het
Cse1l A G 2: 166,783,394 (GRCm39) T783A probably damaging Het
Doc2g A G 19: 4,056,630 (GRCm39) T339A probably benign Het
Eif5a T C 11: 69,808,896 (GRCm39) probably benign Het
Epha3 A G 16: 63,386,940 (GRCm39) probably null Het
Esco1 A T 18: 10,594,355 (GRCm39) C310* probably null Het
Fam222a A G 5: 114,749,101 (GRCm39) Y99C probably damaging Het
Fzd2 T C 11: 102,496,573 (GRCm39) L339P probably damaging Het
Gfral A T 9: 76,104,576 (GRCm39) N145K probably damaging Het
Gga1 T A 15: 78,777,990 (GRCm39) N618K probably benign Het
Gpatch3 T A 4: 133,310,397 (GRCm39) H447Q probably damaging Het
Gpn1 A T 5: 31,666,747 (GRCm39) R346* probably null Het
Gsg1 T C 6: 135,214,558 (GRCm39) E317G probably benign Het
Gsk3b A G 16: 38,004,816 (GRCm39) N129S probably damaging Het
Hmg20b G T 10: 81,184,789 (GRCm39) D94E possibly damaging Het
Kash5 C T 7: 44,849,695 (GRCm39) G76D probably benign Het
Klhdc9 T A 1: 171,187,386 (GRCm39) H204L possibly damaging Het
Klhl24 A G 16: 19,925,638 (GRCm39) I55M probably benign Het
Kmt2c T C 5: 25,520,104 (GRCm39) D2002G probably benign Het
Lama4 A G 10: 38,950,742 (GRCm39) N1015S probably damaging Het
Lpp T C 16: 24,580,697 (GRCm39) C263R probably benign Het
Lrp1b T C 2: 41,159,216 (GRCm39) I1689V Het
Mipep C A 14: 61,022,284 (GRCm39) Q50K probably benign Het
Mx1 T C 16: 97,257,454 (GRCm39) D101G probably benign Het
Nabp2 C G 10: 128,244,676 (GRCm39) E37Q possibly damaging Het
Nme6 A G 9: 109,671,104 (GRCm39) I115V possibly damaging Het
Nup93 A T 8: 94,970,355 (GRCm39) T85S probably benign Het
Oit3 T A 10: 59,266,835 (GRCm39) I224F possibly damaging Het
Parp14 T C 16: 35,678,975 (GRCm39) K331R probably benign Het
Pls1 T A 9: 95,643,443 (GRCm39) T519S probably benign Het
Rcn3 A G 7: 44,736,118 (GRCm39) F197L probably benign Het
Rnf213 C T 11: 119,349,218 (GRCm39) T3773I Het
Rprd1b A T 2: 157,889,877 (GRCm39) I153L probably benign Het
Scel A G 14: 103,829,804 (GRCm39) D462G possibly damaging Het
Sh3bp1 C T 15: 78,794,276 (GRCm39) S548L possibly damaging Het
Sim1 T A 10: 50,860,284 (GRCm39) Y715* probably null Het
Slc18a2 A T 19: 59,282,293 (GRCm39) Q500L possibly damaging Het
Slc5a8 T G 10: 88,722,365 (GRCm39) M66R probably damaging Het
Slco1a6 T C 6: 142,055,246 (GRCm39) T233A probably damaging Het
Smu1 T C 4: 40,739,623 (GRCm39) T396A probably benign Het
Tas2r104 T C 6: 131,662,521 (GRCm39) T63A possibly damaging Het
Tasor2 G A 13: 3,624,979 (GRCm39) A1657V possibly damaging Het
Top2a C T 11: 98,892,199 (GRCm39) A1088T probably benign Het
Ucp1 T C 8: 84,020,577 (GRCm39) F129S probably damaging Het
Unc13b T A 4: 43,091,298 (GRCm39) D41E probably benign Het
Usp10 T G 8: 120,681,631 (GRCm39) V696G probably benign Het
Xylt2 C T 11: 94,557,066 (GRCm39) V745M probably damaging Het
Zbtb49 A T 5: 38,373,820 (GRCm39) N41K probably damaging Het
Zfp109 T A 7: 23,928,779 (GRCm39) D218V probably benign Het
Zfp420 G A 7: 29,575,430 (GRCm39) R550Q probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTGGAGAGTCCTCTTCTTCCTTAG -3'
(R):5'- AGGCGCTCTCAGATTCACTG -3'

Sequencing Primer
(F):5'- AGAGTCCTCTTCTTCCTTAGATACAC -3'
(R):5'- CCCACATAATTGAGGCTTGCCTTAAG -3'
Posted On 2019-06-07