Incidental Mutation 'PIT4585001:Dnajc16'
ID556592
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene NameDnaJ heat shock protein family (Hsp40) member C16
Synonyms4732437J24Rik, 2900037O03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141760189-141790931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141764685 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 609 (Y609C)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000038014
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: Y609C

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R2959:Dnajc16 UTSW 4 141766545 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGGAGAGTCCTCTTCTTCCTTAG -3'
(R):5'- AGGCGCTCTCAGATTCACTG -3'

Sequencing Primer
(F):5'- AGAGTCCTCTTCTTCCTTAGATACAC -3'
(R):5'- CCCACATAATTGAGGCTTGCCTTAAG -3'
Posted On2019-06-07