Incidental Mutation 'R7199:Atad2b'
ID 560188
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7199 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5017992 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 997 (Y997N)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably damaging
Transcript: ENSMUST00000045664
AA Change: Y997N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: Y997N

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,014 T39A probably damaging Het
5430419D17Rik G A 7: 131,235,912 W512* probably null Het
Abca3 G A 17: 24,377,707 G378D probably damaging Het
Abtb2 T C 2: 103,567,220 V165A possibly damaging Het
Ache A G 5: 137,290,242 E70G probably damaging Het
Adamtsl4 T C 3: 95,680,809 T623A probably benign Het
Ahdc1 G A 4: 133,064,624 V1059I probably benign Het
Ajuba G A 14: 54,573,458 Q357* probably null Het
Ano7 A T 1: 93,402,978 D54V Het
Apob A T 12: 8,005,072 D1357V probably damaging Het
Bhlhe22 C A 3: 18,055,842 T352K probably damaging Het
Bsn T C 9: 108,115,334 E1073G probably damaging Het
Bzw2 G A 12: 36,130,055 R58* probably null Het
C7 G T 15: 4,994,243 S694R probably benign Het
Cbr2 T A 11: 120,730,261 H170L probably benign Het
Ckap2l T C 2: 129,285,055 N401S probably benign Het
Cldn1 A G 16: 26,371,596 F11L probably benign Het
Cmtr1 A G 17: 29,676,200 T118A probably benign Het
Cog6 T C 3: 52,983,189 E610G probably benign Het
Col3a1 G T 1: 45,332,141 A451S probably null Het
Cr1l T A 1: 195,117,570 R265S probably benign Het
Dapk1 T C 13: 60,754,210 I951T probably benign Het
Dnah9 T C 11: 66,118,944 N706D probably benign Het
Dpysl5 A T 5: 30,783,195 T239S probably benign Het
Ect2l T A 10: 18,129,146 Y913F probably benign Het
Elf5 C A 2: 103,439,296 A74D possibly damaging Het
Erap1 T C 13: 74,666,139 V399A probably benign Het
Ercc4 A G 16: 13,147,793 D763G probably damaging Het
Fam222b T A 11: 78,154,857 C415S possibly damaging Het
Fat4 A C 3: 38,977,362 N2432T probably damaging Het
Fbn2 G T 18: 58,053,761 C1689* probably null Het
Frrs1l T A 4: 56,972,282 T140S probably damaging Het
Gm14025 A G 2: 129,038,318 S563P Het
Gm5141 A T 13: 62,777,063 H10Q possibly damaging Het
Inafm1 A T 7: 16,273,154 L46Q probably damaging Het
Irak2 T C 6: 113,673,084 L260P probably damaging Het
Kat2b T C 17: 53,670,678 L751P probably damaging Het
Kcnh1 T A 1: 192,337,605 I413N probably benign Het
Kirrel T C 3: 87,083,388 D709G probably benign Het
Lama4 T C 10: 39,080,540 V1153A possibly damaging Het
Lipg A T 18: 74,955,584 F98L probably benign Het
Lman1 T C 18: 65,994,865 E236G probably damaging Het
Lrp1 T A 10: 127,573,456 D1598V probably damaging Het
Lrrc71 T A 3: 87,743,077 N230Y probably damaging Het
Maneal T C 4: 124,857,190 S258G possibly damaging Het
March10 T A 11: 105,390,706 E251V probably damaging Het
Mb21d1 C A 9: 78,433,033 K472N probably benign Het
Mpdz A G 4: 81,297,333 I1484T probably damaging Het
Mtcl1 T A 17: 66,340,539 N1882I probably benign Het
Neb G A 2: 52,220,200 A212V probably benign Het
Obscn G A 11: 59,012,846 S7434L probably benign Het
Olfr1297 T C 2: 111,621,193 M294V probably benign Het
Olfr340 A T 2: 36,452,860 I92F probably damaging Het
Olfr51 T A 11: 51,007,396 C141* probably null Het
Olfr761 A C 17: 37,952,157 I289S probably damaging Het
Olfr971 A G 9: 39,839,457 M8V probably benign Het
Orc6 T C 8: 85,302,961 probably null Het
Otogl T G 10: 107,874,533 E565A possibly damaging Het
Papss1 A G 3: 131,585,138 Q214R probably benign Het
Pck2 G A 14: 55,548,712 V653M probably benign Het
Plxna4 G A 6: 32,215,178 Q826* probably null Het
Pms1 T A 1: 53,256,730 T161S probably benign Het
Prkar2a C A 9: 108,740,470 N242K probably damaging Het
Prss1 T A 6: 41,462,756 I141N probably damaging Het
Puf60 A G 15: 76,071,868 V235A probably damaging Het
Rapgef6 T A 11: 54,546,426 F65Y probably benign Het
Rasgef1b T C 5: 99,300,039 E104G unknown Het
Rcn3 T C 7: 45,084,909 Y225C probably damaging Het
Rhot1 G C 11: 80,246,734 W354S probably damaging Het
Rp1 T C 1: 4,347,290 S1200G possibly damaging Het
Scaper T A 9: 55,838,176 K603* probably null Het
Selenbp1 G A 3: 94,944,434 V429I possibly damaging Het
Setd5 T G 6: 113,121,138 S713A probably benign Het
Shank1 T C 7: 44,353,140 Y1428H possibly damaging Het
Slc11a1 G T 1: 74,383,671 W361L possibly damaging Het
Spta1 A T 1: 174,223,271 D1772V possibly damaging Het
St8sia6 T C 2: 13,656,910 H370R probably damaging Het
Stkld1 A T 2: 26,952,714 D566V probably damaging Het
Tango6 T C 8: 106,689,159 V204A probably benign Het
Tdrd5 G A 1: 156,301,723 A139V probably damaging Het
Tenm2 A T 11: 36,171,436 V534E probably damaging Het
Tfip11 A T 5: 112,331,178 Q204L probably benign Het
Tlr4 A T 4: 66,841,193 Q741L probably damaging Het
Tmem18 A G 12: 30,588,655 M111V probably benign Het
Togaram1 A G 12: 64,995,518 N1167S probably benign Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Trbj2-3 T C 6: 41,543,242 F7S probably damaging Het
Vmn1r212 T A 13: 22,883,561 M201L probably benign Het
Xaf1 C A 11: 72,303,375 C27* probably null Het
Zeb1 T C 18: 5,767,703 V738A probably benign Het
Zfp524 A T 7: 5,017,884 H137L probably damaging Het
Zfyve19 A T 2: 119,216,637 H367L probably damaging Het
Zim1 G A 7: 6,677,873 Q264* probably null Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8894:Atad2b UTSW 12 5014001 critical splice donor site probably null
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACCGTCTGTTTCAGAGGTCAG -3'
(R):5'- TTAATGTCGCCACAGTGTCC -3'

Sequencing Primer
(F):5'- CAGGATGAGCACCATGAAGCTTTTC -3'
(R):5'- ACAGTGTCCTTACCTCCGGG -3'
Posted On 2019-06-26