Mutagenetix > Incidental Mutation

Incidental Mutation 'R2943:Atad2b'

255832

Institutional Source

Beutler Lab

Gene Symbol

Atad2b

Ensembl Gene

ENSMUSG00000052812

Gene Name

ATPase family, AAA domain containing 2B

Synonyms

D530031C13Rik, 1110014E10Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2943 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4917353-5047394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4942067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 222 (T222K)

Ref Sequence

ENSEMBL: ENSMUSP00000047445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045664]

AlphaFold

E9Q166

Predicted Effect

probably damaging
Transcript: ENSMUST00000045664
AA Change: T222K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: T222K

Domain	Start	End	E-Value	Type
low complexity region	13	54	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	252	278	N/A	INTRINSIC
AAA	432	573	4.56e-20	SMART
SCOP:d1e32a2	771	912	3e-4	SMART
BROMO	958	1070	4.24e-20	SMART
low complexity region	1135	1144	N/A	INTRINSIC
low complexity region	1230	1253	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219187

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anln	A	G	9: 22,356,046		probably null	Het
Aqp12	A	T	1: 93,006,665	D88V	probably damaging	Het
Armc5	A	C	7: 128,240,580	N357H	probably damaging	Het
Carmil2	C	T	8: 105,692,932	H815Y	probably benign	Het
Chrna9	T	C	5: 65,977,095	Y430H	probably damaging	Het
Eps8	T	C	6: 137,522,872	D203G	probably damaging	Het
Galnt6	G	T	15: 100,714,279		probably null	Het
Gm5039	T	C	12: 88,321,234	D83G	probably benign	Het
Gsdmc	C	T	15: 63,803,652	V105I	possibly damaging	Het
Kntc1	A	G	5: 123,797,784	D1509G	possibly damaging	Het
Lrp10	C	T	14: 54,469,845		probably benign	Het
Mcmbp	A	T	7: 128,723,973	L97H	probably damaging	Het
Mfsd2a	A	G	4: 122,948,589	L495P	possibly damaging	Het
Olfr601	A	G	7: 103,358,451	C248R	probably damaging	Het
Pank4	G	A	4: 154,971,474	V319I	probably benign	Het
Pde7a	T	C	3: 19,230,325	N365D	probably damaging	Het
Pot1b	A	T	17: 55,674,058	S319T	probably benign	Het
Rbm25	T	C	12: 83,660,641	I276T	probably damaging	Het
Reg1	T	A	6: 78,428,145	L117Q	possibly damaging	Het
Ripor3	T	C	2: 167,983,761	H759R	possibly damaging	Het
Rph3al	A	T	11: 75,834,888		probably null	Het
S1pr4	A	C	10: 81,498,872	L256R	probably damaging	Het
Sstr4	T	C	2: 148,396,165	V232A	probably damaging	Het
Tor3a	G	A	1: 156,674,095	P71S	probably benign	Het
Zfp804a	C	A	2: 82,235,879	Q65K	probably damaging	Het

Other mutations in Atad2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Atad2b	APN	12	5024593	missense	probably damaging	1.00
IGL00917:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01011:Atad2b	APN	12	4965984	missense	probably benign	0.01
IGL01092:Atad2b	APN	12	5017987	missense	probably damaging	0.98
IGL01604:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01924:Atad2b	APN	12	5034093	missense	probably damaging	1.00
IGL02197:Atad2b	APN	12	5018056	missense	possibly damaging	0.84
IGL02397:Atad2b	APN	12	4974046	missense	probably damaging	1.00
IGL02404:Atad2b	APN	12	4941972	missense	probably benign	0.08
IGL02517:Atad2b	APN	12	5018037	missense	probably benign	0.07
IGL02726:Atad2b	APN	12	4974003	nonsense	probably null
IGL02896:Atad2b	APN	12	4958151	missense	probably damaging	1.00
IGL03227:Atad2b	APN	12	5006715	missense	probably damaging	1.00
IGL03265:Atad2b	APN	12	5024628	missense	probably benign	0.24
Plyers	UTSW	12	4973970	missense	probably damaging	1.00
Smidge	UTSW	12	4990949	missense	probably damaging	1.00
Tensor	UTSW	12	4957558	missense	probably damaging	1.00
Traction	UTSW	12	5027182	critical splice donor site	probably null
Vice	UTSW	12	5018002	missense	probably damaging	1.00
K3955:Atad2b	UTSW	12	4954536	splice site	probably benign
P0038:Atad2b	UTSW	12	4954536	splice site	probably benign
PIT4418001:Atad2b	UTSW	12	5024587	missense	probably benign	0.07
PIT4431001:Atad2b	UTSW	12	5031795	missense	possibly damaging	0.77
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0124:Atad2b	UTSW	12	4952676	missense	probably benign	0.23
R0462:Atad2b	UTSW	12	4941973	missense	possibly damaging	0.79
R0483:Atad2b	UTSW	12	4945035	splice site	probably benign
R0617:Atad2b	UTSW	12	4937401	missense	probably benign	0.43
R0894:Atad2b	UTSW	12	4965915	missense	probably damaging	1.00
R0942:Atad2b	UTSW	12	5024591	missense	probably damaging	1.00
R0960:Atad2b	UTSW	12	5006593	splice site	probably benign
R0973:Atad2b	UTSW	12	5031784	missense	probably benign	0.00
R1306:Atad2b	UTSW	12	4974239	missense	probably benign	0.08
R1530:Atad2b	UTSW	12	4942018	nonsense	probably null
R1678:Atad2b	UTSW	12	4965899	missense	possibly damaging	0.91
R1689:Atad2b	UTSW	12	5034575	nonsense	probably null
R1826:Atad2b	UTSW	12	4974094	missense	probably benign	0.00
R1996:Atad2b	UTSW	12	4990883	missense	probably benign	0.01
R2233:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2235:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R3161:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3508:Atad2b	UTSW	12	4950595	critical splice donor site	probably null
R4239:Atad2b	UTSW	12	4985710	missense	probably benign	0.05
R4401:Atad2b	UTSW	12	4940145	missense	probably damaging	0.99
R4558:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4559:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4573:Atad2b	UTSW	12	4954663	splice site	probably null
R4639:Atad2b	UTSW	12	5018053	missense	probably damaging	1.00
R4847:Atad2b	UTSW	12	4944901	splice site	probably null
R4850:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4851:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4979:Atad2b	UTSW	12	5034513	missense	probably damaging	1.00
R5024:Atad2b	UTSW	12	4937534	missense	probably benign	0.45
R5305:Atad2b	UTSW	12	4965855	missense	probably damaging	1.00
R5405:Atad2b	UTSW	12	4940098	missense	possibly damaging	0.87
R5627:Atad2b	UTSW	12	4917911	missense	probably benign	0.01
R5754:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R6163:Atad2b	UTSW	12	4954593	missense	probably benign	0.00
R6371:Atad2b	UTSW	12	4973970	missense	probably damaging	1.00
R6374:Atad2b	UTSW	12	5018002	missense	probably damaging	1.00
R6399:Atad2b	UTSW	12	4957558	missense	probably damaging	1.00
R6433:Atad2b	UTSW	12	4952642	missense	possibly damaging	0.89
R6546:Atad2b	UTSW	12	4990949	missense	probably damaging	1.00
R6617:Atad2b	UTSW	12	5024668	missense	probably benign	0.00
R7199:Atad2b	UTSW	12	5017992	missense	probably damaging	1.00
R7267:Atad2b	UTSW	12	5027105	nonsense	probably null
R7405:Atad2b	UTSW	12	4943232	missense	probably benign	0.08
R7460:Atad2b	UTSW	12	4952660	missense	probably benign	0.28
R7568:Atad2b	UTSW	12	5010390	critical splice donor site	probably null
R7593:Atad2b	UTSW	12	5031726	missense	probably benign	0.16
R7648:Atad2b	UTSW	12	5027182	critical splice donor site	probably null
R8253:Atad2b	UTSW	12	4974159	missense	possibly damaging	0.54
R8253:Atad2b	UTSW	12	4974160	missense	probably benign	0.02
R8708:Atad2b	UTSW	12	4961253	missense	probably damaging	1.00
R8894:Atad2b	UTSW	12	5014001	critical splice donor site	probably null
R8948:Atad2b	UTSW	12	4991012	missense	possibly damaging	0.87
R8976:Atad2b	UTSW	12	4917923	critical splice donor site	probably null
R9052:Atad2b	UTSW	12	4965982	missense	probably damaging	1.00
R9057:Atad2b	UTSW	12	5018102	nonsense	probably null
R9134:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R9450:Atad2b	UTSW	12	5013859	missense	probably benign	0.06
R9453:Atad2b	UTSW	12	5031578	missense	probably benign	0.13
R9494:Atad2b	UTSW	12	5031852	missense	probably benign	0.26
R9634:Atad2b	UTSW	12	5010332	missense	probably damaging	1.00
R9764:Atad2b	UTSW	12	5032064	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACAAGCCCCTTAACGTTTATG -3'
(R):5'- AGAGGCCTACTGCTATTCATCC -3'

Sequencing Primer
(F):5'- GATGTATAAATGTGATCCCACCATTG -3'
(R):5'- AAAAATGTTTTTCTTCCAGGCTTCC -3'

Posted On

2014-12-29