Mutagenetix > Incidental Mutations

Incidental Mutation 'R7239:Nipbl'

563104

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R7239 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 8292135 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

Predicted Effect

probably null
Transcript: ENSMUST00000052965

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.9753

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	A	G	16: 21,653,518	V144A	probably damaging	Het
4930402H24Rik	C	A	2: 130,806,788	R258L	unknown	Het
Abca5	A	T	11: 110,326,704	Y109N	possibly damaging	Het
Abcb5	T	C	12: 118,928,725	Q433R	probably benign	Het
Adamts7	G	A	9: 90,186,557		probably null	Het
Adgrv1	T	C	13: 81,476,612	D3746G	possibly damaging	Het
Arhgap29	C	T	3: 121,988,950	S159L	probably benign	Het
Arhgap5	T	A	12: 52,517,376	C377S	probably benign	Het
Atp1a3	G	A	7: 25,000,704	P77L	probably damaging	Het
B4galt1	T	C	4: 40,812,754	D257G	probably damaging	Het
Bin1	T	A	18: 32,406,171	N52K	probably damaging	Het
Catsperg2	A	G	7: 29,710,082	M562T	probably benign	Het
Ccdc33	G	A	9: 58,032,909	Q713*	probably null	Het
Cd96	A	T	16: 46,109,114	L156Q	probably damaging	Het
Clpb	A	G	7: 101,711,455	T231A	probably damaging	Het
Dnmt3a	A	T	12: 3,872,850	Q151L	probably benign	Het
Dock2	C	T	11: 34,231,677	V1629M	probably benign	Het
Edem1	G	A	6: 108,854,380	D601N	probably benign	Het
Eno2	C	T	6: 124,768,265	V20M	probably damaging	Het
Eny2	A	C	15: 44,433,854	D52A	probably benign	Het
Esp36	T	C	17: 38,417,241	R93G	possibly damaging	Het
Fam227a	A	G	15: 79,634,062		probably null	Het
Fat4	C	A	3: 38,983,840	H3880Q	possibly damaging	Het
Fbxw24	A	T	9: 109,605,530	V334E	possibly damaging	Het
Flrt1	T	C	19: 7,095,964	Q406R	probably benign	Het
Frmpd2	A	G	14: 33,552,077	N1092S	probably benign	Het
Gm904	C	A	13: 50,645,251	T82K	probably benign	Het
Gnas	G	C	2: 174,298,615	G252R	unknown	Het
Gpatch2l	A	G	12: 86,260,575		probably null	Het
Hist1h2ac	A	T	13: 23,683,610	I103N	probably damaging	Het
Ift74	T	C	4: 94,652,950	V204A	probably benign	Het
Ikzf4	A	G	10: 128,641,244	L119P	probably damaging	Het
Ing3	G	A	6: 21,952,194	E56K	probably damaging	Het
Klhl25	T	C	7: 75,866,768	I474T	probably benign	Het
Klhl5	T	C	5: 65,161,186	V556A	probably damaging	Het
Krt14	A	T	11: 100,204,255	M382K	probably benign	Het
Lmcd1	T	C	6: 112,315,784	V199A	possibly damaging	Het
Lpcat4	T	A	2: 112,242,707	F200I	possibly damaging	Het
Lrp1b	T	C	2: 41,004,713	T2282A		Het
Lrrk1	T	C	7: 66,262,155	T1886A	probably benign	Het
Meis2	T	C	2: 116,059,003		probably null	Het
Mki67	C	T	7: 135,700,176	R1043K	possibly damaging	Het
Myct1	G	T	10: 5,604,601	R156L	possibly damaging	Het
Nckap5l	G	T	15: 99,426,209	H804Q	probably damaging	Het
Ndst3	T	G	3: 123,606,906	E450D	probably damaging	Het
Npy	A	G	6: 49,823,607	N4D	probably benign	Het
Olfr855	A	T	9: 19,585,191	Y218F	probably damaging	Het
Osgin2	T	C	4: 16,008,748	S18G	probably benign	Het
Pcdha9	T	G	18: 36,998,498	F207V	probably benign	Het
Pcdhb13	A	T	18: 37,444,644	I692F	probably damaging	Het
Pde3b	T	A	7: 114,416,149	V200E	probably damaging	Het
Ppp6r3	A	T	19: 3,493,981	L345I	probably benign	Het
Psd2	G	A	18: 35,980,419	A315T	probably damaging	Het
Rnf111	G	A	9: 70,469,373	T328I	probably damaging	Het
Rnf213	T	C	11: 119,458,788	L3825P		Het
Rtl1	C	T	12: 109,592,475	V977I	probably benign	Het
Scn1a	G	A	2: 66,277,656		probably null	Het
Slc25a2	G	T	18: 37,637,695	N260K	probably benign	Het
Sprtn	T	C	8: 124,900,244	V121A	probably damaging	Het
Ssx2ip	T	G	3: 146,428,016	L260W	probably damaging	Het
Syde1	G	A	10: 78,588,781	R406C	probably damaging	Het
Tab1	A	G	15: 80,133,171	R6G	probably benign	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tenm4	G	A	7: 96,735,813	V526I	possibly damaging	Het
Tfap2b	T	C	1: 19,234,180	F405L	probably damaging	Het
Trbv13-1	C	A	6: 41,116,391	T87K	probably benign	Het
Trmt44	G	T	5: 35,574,786	A87E	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttn	T	C	2: 76,787,290	D16279G	probably damaging	Het
Ttn	G	A	2: 76,881,328	R8290C	unknown	Het
Ugt2b37	T	A	5: 87,254,731	I14L	probably benign	Het
Vmn1r13	A	T	6: 57,210,626	M257L	probably benign	Het
Vmn1r184	C	T	7: 26,267,177	P116L	possibly damaging	Het
Zfp426	T	C	9: 20,470,591	T367A	probably benign	Het
Zfp647	A	T	15: 76,911,756	C235S	probably damaging	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8366673	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8369474	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8296869	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8350455	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8350497	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8311209	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8350539	missense	probably benign
IGL01723:Nipbl	APN	15	8335071	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8361821	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8327090	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8359074	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8343574	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8323647	splice site	probably null
IGL02547:Nipbl	APN	15	8351598	missense	probably benign
IGL02678:Nipbl	APN	15	8351110	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8295553	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8350314	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8332452	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8338979	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8293085	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8350876	missense	probably benign	0.12
R0271:Nipbl	UTSW	15	8361737	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8360956	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8350732	missense	probably benign
R0422:Nipbl	UTSW	15	8351628	missense	probably benign
R0486:Nipbl	UTSW	15	8338870	splice site	probably benign
R0652:Nipbl	UTSW	15	8303480	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8361004	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8293078	splice site	probably null
R0726:Nipbl	UTSW	15	8351555	missense	probably benign
R0881:Nipbl	UTSW	15	8307612	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8361718	missense	probably benign
R0969:Nipbl	UTSW	15	8292228	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8372173	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8350289	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8351280	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8366664	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8302912	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8338551	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8319488	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8343517	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8327132	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8343630	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8350287	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8324467	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8311207	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8336919	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8293218	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8351482	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8335006	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8323698	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8311239	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8343592	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8333024	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8295661	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8358874	missense	probably benign
R3902:Nipbl	UTSW	15	8350246	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8350534	missense	probably benign
R4164:Nipbl	UTSW	15	8338934	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8332432	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8359206	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8361861	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8338724	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8366658	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8302984	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8365829	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8351497	missense	probably benign
R5428:Nipbl	UTSW	15	8330296	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8366712	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8358907	missense	probably benign
R5644:Nipbl	UTSW	15	8358907	missense	probably benign
R5681:Nipbl	UTSW	15	8301382	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8324649	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8334844	splice site	probably null
R5970:Nipbl	UTSW	15	8296818	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8324264	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8295568	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8334906	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8318383	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8324580	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8300895	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8300784	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8351565	missense	probably benign
R6707:Nipbl	UTSW	15	8324559	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8322590	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8303485	missense	probably benign	0.28
R7346:Nipbl	UTSW	15	8343606	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8330295	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8295636	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8343493	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8305872	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8293101	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8351526	missense	probably benign	0.01
X0022:Nipbl	UTSW	15	8351715	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8323537	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8307882	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCCAAGGGGTTAACGTATACTTG -3'
(R):5'- CATCTAGACCCTGATGAAGAAGAAG -3'

Sequencing Primer
(F):5'- GGGGTTAACGTATACTTGTAAAACC -3'
(R):5'- CCCTGATGAAGAAGAAGAGGAAG -3'

Posted On

2019-06-26