Mutagenetix > Incidental Mutations

Incidental Mutation 'R7292:Trank1'

566500

Institutional Source

Beutler Lab

Gene Symbol

Trank1

Ensembl Gene

ENSMUSG00000062296

Gene Name

tetratricopeptide repeat and ankyrin repeat containing 1

Synonyms

A230061D21Rik, LOC235639, C030048J01Rik, Lba1

MMRRC Submission

Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7292 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111311739-111395775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 111377870 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1690 (R1690S)

Ref Sequence

ENSEMBL: ENSMUSP00000077697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078626]

Predicted Effect

probably benign
Transcript: ENSMUST00000078626
AA Change: R1690S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: R1690S

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
low complexity region	34	52	N/A	INTRINSIC
low complexity region	113	129	N/A	INTRINSIC
Blast:TPR	144	177	1e-15	BLAST
Blast:TPR	178	209	8e-13	BLAST
Blast:ANK	332	361	1e-6	BLAST
ANK	369	405	5.29e0	SMART
ANK	538	567	2.11e2	SMART
ANK	572	609	7.29e2	SMART
ANK	621	652	1.21e2	SMART
low complexity region	887	895	N/A	INTRINSIC
low complexity region	1152	1172	N/A	INTRINSIC
Blast:AAA	1351	1569	1e-6	BLAST
low complexity region	2166	2177	N/A	INTRINSIC
low complexity region	2395	2411	N/A	INTRINSIC
low complexity region	2636	2649	N/A	INTRINSIC
low complexity region	2966	2983	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (66/66)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
1700010I14Rik	T	A	17: 8,997,029	C322*	probably null	Het
1700019N19Rik	A	T	19: 58,789,107	Y90*	probably null	Het
2310035C23Rik	G	T	1: 105,721,416		probably null	Het
4930553M12Rik	G	A	4: 88,868,331	R17C	unknown	Het
Abcc8	G	A	7: 46,135,526	T726I	probably benign	Het
Adamts18	T	C	8: 113,709,645	T981A	probably benign	Het
Adgrb3	A	G	1: 25,531,876	C507R	probably damaging	Het
Bloc1s6	T	A	2: 122,742,695	D63E	probably damaging	Het
Cdc25b	C	T	2: 131,191,173	R135W	probably damaging	Het
Cdca2	G	T	14: 67,677,877	Y644*	probably null	Het
Ceacam10	G	T	7: 24,778,350	G97C	probably damaging	Het
Cenpf	G	A	1: 189,650,694	L2668F	probably damaging	Het
Cog4	A	G	8: 110,881,828	D774G	probably damaging	Het
Col11a2	G	A	17: 34,051,508	G511E	unknown	Het
Col19a1	T	A	1: 24,530,008	I220F	unknown	Het
Cubn	G	T	2: 13,424,739	T1317K	probably damaging	Het
Dnaaf5	T	C	5: 139,150,317	L24P	unknown	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Foxn4	C	A	5: 114,258,655	E256*	probably null	Het
Gm4869	A	G	5: 140,471,670	D398G	probably benign	Het
Gm5580	G	A	6: 116,551,477	R105Q	probably damaging	Het
Gm5930	A	G	14: 44,336,557	S108P	probably damaging	Het
Gnl3	A	G	14: 31,013,232	S468P	probably benign	Het
Gzmb	A	T	14: 56,262,119	S11T	probably benign	Het
Hmcn1	T	C	1: 150,733,129		probably null	Het
Ifi206	A	G	1: 173,473,862	L750P	unknown	Het
Ifi213	T	A	1: 173,595,125	E58V	probably damaging	Het
Igkv4-78	A	T	6: 69,059,768	Y94N	probably damaging	Het
Igsf9	G	T	1: 172,491,757		probably null	Het
Itpr2	G	T	6: 146,158,949	L2490M	possibly damaging	Het
Kdm2b	A	G	5: 122,880,791	F862S	probably damaging	Het
Meis1	A	G	11: 19,011,351	I174T	probably damaging	Het
Micu3	A	G	8: 40,382,125	Q507R	probably benign	Het
Mpp4	C	T	1: 59,143,810	E313K	possibly damaging	Het
Nfatc4	G	A	14: 55,825,055	E7K	probably damaging	Het
Olfr466	T	A	13: 65,152,842	V206D	possibly damaging	Het
Olfr828	A	T	9: 18,816,190	Y35N	probably damaging	Het
Osbpl5	G	A	7: 143,701,278	P470S	probably damaging	Het
Pak6	A	G	2: 118,693,591	D409G	possibly damaging	Het
Pkhd1l1	T	A	15: 44,498,590	M553K	probably benign	Het
Ppp2r3a	T	C	9: 101,212,672	N151D	probably damaging	Het
Prdm12	T	C	2: 31,643,850	W160R	probably damaging	Het
Prdm2	G	A	4: 143,132,901	T1273M	possibly damaging	Het
Prl2a1	A	G	13: 27,807,370		probably null	Het
Prob1	G	A	18: 35,654,550	P217L	possibly damaging	Het
Ramp1	A	C	1: 91,196,777	H20P	probably benign	Het
Rbm47	T	A	5: 66,026,750	E170V	possibly damaging	Het
Rpn1	C	T	6: 88,090,084	P142L	probably damaging	Het
Rsu1	C	T	2: 13,170,016	R238H	probably damaging	Het
Sh3rf3	C	T	10: 59,071,973	P441L	probably damaging	Het
Slc1a6	A	G	10: 78,814,604	S559G	possibly damaging	Het
Slc35f5	C	A	1: 125,572,485	S245R	probably damaging	Het
Spcs3	T	C	8: 54,526,519	N76D	probably benign	Het
Svep1	T	C	4: 58,111,395	T1075A	possibly damaging	Het
Sympk	A	T	7: 19,036,030	I211F	probably benign	Het
Tk1	C	T	11: 117,825,777	M1I	probably null	Het
Tln2	A	G	9: 67,346,461	V776A	probably benign	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tnk2	T	C	16: 32,680,800	V977A	probably benign	Het
Toporsl	A	T	4: 52,611,630	S508C	probably benign	Het
Trio	T	A	15: 27,828,351	Q1409L	possibly damaging	Het
Vit	T	C	17: 78,605,498	F287L	probably benign	Het
Vmn2r109	G	C	17: 20,541,438	D552E	probably benign	Het
Zw10	T	C	9: 49,061,191	V186A	probably benign	Het

Other mutations in Trank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Trank1	APN	9	111392609	missense	probably damaging	1.00
IGL00467:Trank1	APN	9	111364666	splice site	probably benign
IGL00569:Trank1	APN	9	111345511	missense	possibly damaging	0.69
IGL00585:Trank1	APN	9	111349290	missense	possibly damaging	0.82
IGL01070:Trank1	APN	9	111366793	missense	probably damaging	1.00
IGL01134:Trank1	APN	9	111391781	missense	probably benign
IGL01154:Trank1	APN	9	111386400	missense	probably benign	0.00
IGL01355:Trank1	APN	9	111365520	missense	possibly damaging	0.94
IGL01407:Trank1	APN	9	111364722	missense	probably damaging	0.99
IGL01410:Trank1	APN	9	111365049	missense	probably benign	0.00
IGL01410:Trank1	APN	9	111365259	missense	probably benign	0.00
IGL01504:Trank1	APN	9	111373544	missense	probably damaging	1.00
IGL01744:Trank1	APN	9	111349363	missense	probably damaging	1.00
IGL02043:Trank1	APN	9	111363960	missense	probably damaging	0.98
IGL02104:Trank1	APN	9	111390712	missense	possibly damaging	0.85
IGL02193:Trank1	APN	9	111367276	missense	probably benign	0.43
IGL02581:Trank1	APN	9	111383125	missense	probably benign	0.00
IGL02630:Trank1	APN	9	111373075	missense	possibly damaging	0.70
IGL02839:Trank1	APN	9	111364756	missense	probably damaging	1.00
IGL02897:Trank1	APN	9	111367517	missense	probably damaging	0.99
IGL03065:Trank1	APN	9	111390293	missense	possibly damaging	0.64
IGL03123:Trank1	APN	9	111367407	missense	probably damaging	1.00
IGL03143:Trank1	APN	9	111366087	missense	probably damaging	1.00
IGL03323:Trank1	APN	9	111352116	missense	probably damaging	1.00
1mM(1):Trank1	UTSW	9	111392981	missense	probably damaging	1.00
PIT4486001:Trank1	UTSW	9	111390107	missense	probably damaging	1.00
PIT4812001:Trank1	UTSW	9	111347912	missense	probably damaging	1.00
R0035:Trank1	UTSW	9	111366776	missense	probably benign	0.00
R0064:Trank1	UTSW	9	111343195	missense	probably damaging	1.00
R0064:Trank1	UTSW	9	111343195	missense	probably damaging	1.00
R0089:Trank1	UTSW	9	111392910	missense	probably benign	0.00
R0207:Trank1	UTSW	9	111366253	missense	probably damaging	1.00
R0255:Trank1	UTSW	9	111366024	missense	possibly damaging	0.92
R0334:Trank1	UTSW	9	111365353	missense	probably benign	0.00
R0334:Trank1	UTSW	9	111392940	missense	probably damaging	1.00
R0383:Trank1	UTSW	9	111391477	missense	probably benign	0.08
R0421:Trank1	UTSW	9	111391839	missense	probably damaging	1.00
R0494:Trank1	UTSW	9	111391293	missense	probably benign	0.19
R0518:Trank1	UTSW	9	111333808	missense	probably damaging	1.00
R0560:Trank1	UTSW	9	111391086	missense	possibly damaging	0.88
R0637:Trank1	UTSW	9	111390441	missense	probably damaging	1.00
R0731:Trank1	UTSW	9	111365488	missense	probably damaging	1.00
R0761:Trank1	UTSW	9	111366613	missense	probably damaging	1.00
R0766:Trank1	UTSW	9	111347469	missense	probably benign	0.45
R0827:Trank1	UTSW	9	111349417	unclassified	probably benign
R1005:Trank1	UTSW	9	111333721	missense	probably benign	0.13
R1108:Trank1	UTSW	9	111365307	missense	probably benign	0.00
R1155:Trank1	UTSW	9	111366970	missense	possibly damaging	0.95
R1470:Trank1	UTSW	9	111343232	missense	possibly damaging	0.91
R1470:Trank1	UTSW	9	111343232	missense	possibly damaging	0.91
R1596:Trank1	UTSW	9	111366290	missense	possibly damaging	0.93
R1601:Trank1	UTSW	9	111373477	missense	probably damaging	1.00
R1751:Trank1	UTSW	9	111391479	missense	probably benign
R1754:Trank1	UTSW	9	111392871	missense	probably benign	0.00
R1767:Trank1	UTSW	9	111391479	missense	probably benign
R1768:Trank1	UTSW	9	111392927	missense	probably damaging	0.96
R1809:Trank1	UTSW	9	111392825	missense	probably benign	0.34
R1912:Trank1	UTSW	9	111390709	missense	probably benign	0.00
R1920:Trank1	UTSW	9	111347928	critical splice donor site	probably null
R1960:Trank1	UTSW	9	111391628	missense	probably damaging	1.00
R1993:Trank1	UTSW	9	111378832	missense	probably benign	0.20
R2012:Trank1	UTSW	9	111365028	missense	probably benign
R2025:Trank1	UTSW	9	111392039	missense	probably benign	0.01
R2050:Trank1	UTSW	9	111364788	missense	probably damaging	1.00
R2857:Trank1	UTSW	9	111366933	missense	probably benign	0.00
R2912:Trank1	UTSW	9	111392483	missense	probably damaging	0.98
R2962:Trank1	UTSW	9	111352080	missense	probably damaging	1.00
R3030:Trank1	UTSW	9	111391530	missense	possibly damaging	0.63
R3821:Trank1	UTSW	9	111378819	missense	probably damaging	1.00
R3822:Trank1	UTSW	9	111378819	missense	probably damaging	1.00
R3892:Trank1	UTSW	9	111364759	missense	probably benign	0.03
R4105:Trank1	UTSW	9	111352197	missense	probably damaging	1.00
R4166:Trank1	UTSW	9	111373524	nonsense	probably null
R4237:Trank1	UTSW	9	111367035	missense	probably benign	0.04
R4239:Trank1	UTSW	9	111367035	missense	probably benign	0.04
R4394:Trank1	UTSW	9	111365197	missense	possibly damaging	0.86
R4417:Trank1	UTSW	9	111365968	missense	probably benign	0.17
R4611:Trank1	UTSW	9	111362261	missense	probably damaging	1.00
R4694:Trank1	UTSW	9	111392061	missense	probably benign	0.40
R4731:Trank1	UTSW	9	111390410	missense	probably damaging	1.00
R4843:Trank1	UTSW	9	111366078	missense	probably benign	0.00
R4852:Trank1	UTSW	9	111391895	missense	possibly damaging	0.68
R4859:Trank1	UTSW	9	111365010	missense	probably benign	0.17
R4868:Trank1	UTSW	9	111365641	missense	probably damaging	1.00
R5080:Trank1	UTSW	9	111389221	missense	probably damaging	0.99
R5156:Trank1	UTSW	9	111390694	missense	probably damaging	1.00
R5174:Trank1	UTSW	9	111365559	missense	probably benign	0.00
R5234:Trank1	UTSW	9	111386467	missense	probably damaging	1.00
R5386:Trank1	UTSW	9	111362402	missense	probably benign	0.12
R5419:Trank1	UTSW	9	111391301	missense	probably damaging	1.00
R5435:Trank1	UTSW	9	111391890	missense	probably benign	0.00
R5444:Trank1	UTSW	9	111392958	missense	probably benign	0.04
R5543:Trank1	UTSW	9	111366112	missense	probably damaging	0.97
R5560:Trank1	UTSW	9	111390567	missense	probably damaging	1.00
R5772:Trank1	UTSW	9	111366676	missense	possibly damaging	0.86
R5774:Trank1	UTSW	9	111391226	missense	probably damaging	1.00
R5843:Trank1	UTSW	9	111365860	missense	possibly damaging	0.59
R5858:Trank1	UTSW	9	111392536	missense	probably benign
R5878:Trank1	UTSW	9	111366685	missense	possibly damaging	0.93
R5900:Trank1	UTSW	9	111391716	missense	probably damaging	1.00
R5917:Trank1	UTSW	9	111362417	missense	probably benign	0.38
R5954:Trank1	UTSW	9	111365133	missense	probably benign	0.13
R6041:Trank1	UTSW	9	111377796	missense	possibly damaging	0.94
R6112:Trank1	UTSW	9	111391737	missense	probably damaging	1.00
R6165:Trank1	UTSW	9	111391872	missense	probably benign	0.00
R6255:Trank1	UTSW	9	111352246	critical splice donor site	probably null
R6395:Trank1	UTSW	9	111367200	missense	probably damaging	1.00
R6567:Trank1	UTSW	9	111347521	missense	probably benign	0.02
R6644:Trank1	UTSW	9	111364834	missense	possibly damaging	0.85
R6724:Trank1	UTSW	9	111365916	missense	probably damaging	1.00
R6788:Trank1	UTSW	9	111390679	missense	probably damaging	1.00
R6831:Trank1	UTSW	9	111377899	missense	probably benign	0.00
R6934:Trank1	UTSW	9	111373090	missense	probably damaging	0.99
R7127:Trank1	UTSW	9	111365796	missense	possibly damaging	0.85
R7206:Trank1	UTSW	9	111345515	critical splice donor site	probably null
R7236:Trank1	UTSW	9	111373074	missense	possibly damaging	0.93
R7247:Trank1	UTSW	9	111367512	missense	probably damaging	1.00
R7310:Trank1	UTSW	9	111367126	missense	probably damaging	1.00
R7431:Trank1	UTSW	9	111362402	missense	probably benign	0.12
R7448:Trank1	UTSW	9	111366349	missense	probably benign	0.01
R7477:Trank1	UTSW	9	111364957	missense	probably benign	0.00
R7514:Trank1	UTSW	9	111364756	missense	probably damaging	1.00
R7595:Trank1	UTSW	9	111365991	missense	probably damaging	1.00
R7637:Trank1	UTSW	9	111365296	missense	possibly damaging	0.71
R7648:Trank1	UTSW	9	111391685	missense	probably benign
R7737:Trank1	UTSW	9	111366012	nonsense	probably null
R7784:Trank1	UTSW	9	111364103	missense	probably damaging	1.00
R7884:Trank1	UTSW	9	111392516	missense	probably benign
R7912:Trank1	UTSW	9	111391528	missense	probably benign	0.04
R7938:Trank1	UTSW	9	111365028	missense	probably benign
R7979:Trank1	UTSW	9	111377899	missense	probably benign	0.00
R8064:Trank1	UTSW	9	111352076	nonsense	probably null
R8100:Trank1	UTSW	9	111392793	missense	probably damaging	1.00
R8124:Trank1	UTSW	9	111378927	missense	probably benign	0.31
R8198:Trank1	UTSW	9	111390812	missense	probably benign	0.09
R8219:Trank1	UTSW	9	111364909	missense	probably damaging	1.00
R8223:Trank1	UTSW	9	111365889	missense	probably damaging	1.00
R8316:Trank1	UTSW	9	111349302	missense	probably benign	0.38
R8347:Trank1	UTSW	9	111367249	missense	probably damaging	1.00
R8436:Trank1	UTSW	9	111391382	missense	possibly damaging	0.86
R8489:Trank1	UTSW	9	111390275	missense	probably benign	0.01
R8682:Trank1	UTSW	9	111365344	missense	probably benign	0.01
R8768:Trank1	UTSW	9	111389276	missense	probably benign	0.00
R8770:Trank1	UTSW	9	111390824	missense	probably benign	0.00
X0064:Trank1	UTSW	9	111343236	missense	possibly damaging	0.57
Z1088:Trank1	UTSW	9	111364710	missense	probably damaging	0.99
Z1177:Trank1	UTSW	9	111311902	missense	unknown
Z1177:Trank1	UTSW	9	111367377	missense	possibly damaging	0.83
Z1177:Trank1	UTSW	9	111392870	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- ATGTCTCCCTCTATGCAGTGTG -3'
(R):5'- CTCCCACTGCTGATATAATGGAAG -3'

Sequencing Primer
(F):5'- TGTGTTGAAGGCTCCACAC -3'
(R):5'- CTGCTGATATAATGGAAGGCAGCC -3'

Posted On

2019-06-26