Incidental Mutation 'R8347:Trank1'
ID 645308
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Name tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms A230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 067867-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Essential gene? Non essential (E-score: 0.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111311739-111395775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111367249 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 1447 (L1447Q)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: L1447Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: L1447Q

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111,392,609 (GRCm38) missense probably damaging 1.00
IGL00467:Trank1 APN 9 111,364,666 (GRCm38) splice site probably benign
IGL00569:Trank1 APN 9 111,345,511 (GRCm38) missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111,349,290 (GRCm38) missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111,366,793 (GRCm38) missense probably damaging 1.00
IGL01134:Trank1 APN 9 111,391,781 (GRCm38) missense probably benign
IGL01154:Trank1 APN 9 111,386,400 (GRCm38) missense probably benign 0.00
IGL01355:Trank1 APN 9 111,365,520 (GRCm38) missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111,364,722 (GRCm38) missense probably damaging 0.99
IGL01410:Trank1 APN 9 111,365,049 (GRCm38) missense probably benign 0.00
IGL01410:Trank1 APN 9 111,365,259 (GRCm38) missense probably benign 0.00
IGL01504:Trank1 APN 9 111,373,544 (GRCm38) missense probably damaging 1.00
IGL01744:Trank1 APN 9 111,349,363 (GRCm38) missense probably damaging 1.00
IGL02043:Trank1 APN 9 111,363,960 (GRCm38) missense probably damaging 0.98
IGL02104:Trank1 APN 9 111,390,712 (GRCm38) missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111,367,276 (GRCm38) missense probably benign 0.43
IGL02581:Trank1 APN 9 111,383,125 (GRCm38) missense probably benign 0.00
IGL02630:Trank1 APN 9 111,373,075 (GRCm38) missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111,364,756 (GRCm38) missense probably damaging 1.00
IGL02897:Trank1 APN 9 111,367,517 (GRCm38) missense probably damaging 0.99
IGL03065:Trank1 APN 9 111,390,293 (GRCm38) missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111,367,407 (GRCm38) missense probably damaging 1.00
IGL03143:Trank1 APN 9 111,366,087 (GRCm38) missense probably damaging 1.00
IGL03323:Trank1 APN 9 111,352,116 (GRCm38) missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111,392,981 (GRCm38) missense probably damaging 1.00
PIT4486001:Trank1 UTSW 9 111,390,107 (GRCm38) missense probably damaging 1.00
PIT4812001:Trank1 UTSW 9 111,347,912 (GRCm38) missense probably damaging 1.00
R0035:Trank1 UTSW 9 111,366,776 (GRCm38) missense probably benign 0.00
R0064:Trank1 UTSW 9 111,343,195 (GRCm38) missense probably damaging 1.00
R0064:Trank1 UTSW 9 111,343,195 (GRCm38) missense probably damaging 1.00
R0089:Trank1 UTSW 9 111,392,910 (GRCm38) missense probably benign 0.00
R0207:Trank1 UTSW 9 111,366,253 (GRCm38) missense probably damaging 1.00
R0255:Trank1 UTSW 9 111,366,024 (GRCm38) missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111,392,940 (GRCm38) missense probably damaging 1.00
R0334:Trank1 UTSW 9 111,365,353 (GRCm38) missense probably benign 0.00
R0383:Trank1 UTSW 9 111,391,477 (GRCm38) missense probably benign 0.08
R0421:Trank1 UTSW 9 111,391,839 (GRCm38) missense probably damaging 1.00
R0494:Trank1 UTSW 9 111,391,293 (GRCm38) missense probably benign 0.19
R0518:Trank1 UTSW 9 111,333,808 (GRCm38) missense probably damaging 1.00
R0560:Trank1 UTSW 9 111,391,086 (GRCm38) missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111,390,441 (GRCm38) missense probably damaging 1.00
R0731:Trank1 UTSW 9 111,365,488 (GRCm38) missense probably damaging 1.00
R0761:Trank1 UTSW 9 111,366,613 (GRCm38) missense probably damaging 1.00
R0766:Trank1 UTSW 9 111,347,469 (GRCm38) missense probably benign 0.45
R0827:Trank1 UTSW 9 111,349,417 (GRCm38) unclassified probably benign
R1005:Trank1 UTSW 9 111,333,721 (GRCm38) missense probably benign 0.13
R1108:Trank1 UTSW 9 111,365,307 (GRCm38) missense probably benign 0.00
R1155:Trank1 UTSW 9 111,366,970 (GRCm38) missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111,343,232 (GRCm38) missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111,343,232 (GRCm38) missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111,366,290 (GRCm38) missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111,373,477 (GRCm38) missense probably damaging 1.00
R1751:Trank1 UTSW 9 111,391,479 (GRCm38) missense probably benign
R1754:Trank1 UTSW 9 111,392,871 (GRCm38) missense probably benign 0.00
R1767:Trank1 UTSW 9 111,391,479 (GRCm38) missense probably benign
R1768:Trank1 UTSW 9 111,392,927 (GRCm38) missense probably damaging 0.96
R1809:Trank1 UTSW 9 111,392,825 (GRCm38) missense probably benign 0.34
R1912:Trank1 UTSW 9 111,390,709 (GRCm38) missense probably benign 0.00
R1920:Trank1 UTSW 9 111,347,928 (GRCm38) critical splice donor site probably null
R1960:Trank1 UTSW 9 111,391,628 (GRCm38) missense probably damaging 1.00
R1993:Trank1 UTSW 9 111,378,832 (GRCm38) missense probably benign 0.20
R2012:Trank1 UTSW 9 111,365,028 (GRCm38) missense probably benign
R2025:Trank1 UTSW 9 111,392,039 (GRCm38) missense probably benign 0.01
R2050:Trank1 UTSW 9 111,364,788 (GRCm38) missense probably damaging 1.00
R2857:Trank1 UTSW 9 111,366,933 (GRCm38) missense probably benign 0.00
R2912:Trank1 UTSW 9 111,392,483 (GRCm38) missense probably damaging 0.98
R2962:Trank1 UTSW 9 111,352,080 (GRCm38) missense probably damaging 1.00
R3030:Trank1 UTSW 9 111,391,530 (GRCm38) missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111,378,819 (GRCm38) missense probably damaging 1.00
R3822:Trank1 UTSW 9 111,378,819 (GRCm38) missense probably damaging 1.00
R3892:Trank1 UTSW 9 111,364,759 (GRCm38) missense probably benign 0.03
R4105:Trank1 UTSW 9 111,352,197 (GRCm38) missense probably damaging 1.00
R4166:Trank1 UTSW 9 111,373,524 (GRCm38) nonsense probably null
R4237:Trank1 UTSW 9 111,367,035 (GRCm38) missense probably benign 0.04
R4239:Trank1 UTSW 9 111,367,035 (GRCm38) missense probably benign 0.04
R4394:Trank1 UTSW 9 111,365,197 (GRCm38) missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111,365,968 (GRCm38) missense probably benign 0.17
R4611:Trank1 UTSW 9 111,362,261 (GRCm38) missense probably damaging 1.00
R4694:Trank1 UTSW 9 111,392,061 (GRCm38) missense probably benign 0.40
R4731:Trank1 UTSW 9 111,390,410 (GRCm38) missense probably damaging 1.00
R4843:Trank1 UTSW 9 111,366,078 (GRCm38) missense probably benign 0.00
R4852:Trank1 UTSW 9 111,391,895 (GRCm38) missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111,365,010 (GRCm38) missense probably benign 0.17
R4868:Trank1 UTSW 9 111,365,641 (GRCm38) missense probably damaging 1.00
R5080:Trank1 UTSW 9 111,389,221 (GRCm38) missense probably damaging 0.99
R5156:Trank1 UTSW 9 111,390,694 (GRCm38) missense probably damaging 1.00
R5174:Trank1 UTSW 9 111,365,559 (GRCm38) missense probably benign 0.00
R5234:Trank1 UTSW 9 111,386,467 (GRCm38) missense probably damaging 1.00
R5386:Trank1 UTSW 9 111,362,402 (GRCm38) missense probably benign 0.12
R5419:Trank1 UTSW 9 111,391,301 (GRCm38) missense probably damaging 1.00
R5435:Trank1 UTSW 9 111,391,890 (GRCm38) missense probably benign 0.00
R5444:Trank1 UTSW 9 111,392,958 (GRCm38) missense probably benign 0.04
R5543:Trank1 UTSW 9 111,366,112 (GRCm38) missense probably damaging 0.97
R5560:Trank1 UTSW 9 111,390,567 (GRCm38) missense probably damaging 1.00
R5772:Trank1 UTSW 9 111,366,676 (GRCm38) missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111,391,226 (GRCm38) missense probably damaging 1.00
R5843:Trank1 UTSW 9 111,365,860 (GRCm38) missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111,392,536 (GRCm38) missense probably benign
R5878:Trank1 UTSW 9 111,366,685 (GRCm38) missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111,391,716 (GRCm38) missense probably damaging 1.00
R5917:Trank1 UTSW 9 111,362,417 (GRCm38) missense probably benign 0.38
R5954:Trank1 UTSW 9 111,365,133 (GRCm38) missense probably benign 0.13
R6041:Trank1 UTSW 9 111,377,796 (GRCm38) missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111,391,737 (GRCm38) missense probably damaging 1.00
R6165:Trank1 UTSW 9 111,391,872 (GRCm38) missense probably benign 0.00
R6255:Trank1 UTSW 9 111,352,246 (GRCm38) critical splice donor site probably null
R6395:Trank1 UTSW 9 111,367,200 (GRCm38) missense probably damaging 1.00
R6567:Trank1 UTSW 9 111,347,521 (GRCm38) missense probably benign 0.02
R6644:Trank1 UTSW 9 111,364,834 (GRCm38) missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111,365,916 (GRCm38) missense probably damaging 1.00
R6788:Trank1 UTSW 9 111,390,679 (GRCm38) missense probably damaging 1.00
R6831:Trank1 UTSW 9 111,377,899 (GRCm38) missense probably benign 0.00
R6934:Trank1 UTSW 9 111,373,090 (GRCm38) missense probably damaging 0.99
R7127:Trank1 UTSW 9 111,365,796 (GRCm38) missense possibly damaging 0.85
R7206:Trank1 UTSW 9 111,345,515 (GRCm38) critical splice donor site probably null
R7236:Trank1 UTSW 9 111,373,074 (GRCm38) missense possibly damaging 0.93
R7247:Trank1 UTSW 9 111,367,512 (GRCm38) missense probably damaging 1.00
R7292:Trank1 UTSW 9 111,377,870 (GRCm38) missense probably benign 0.02
R7310:Trank1 UTSW 9 111,367,126 (GRCm38) missense probably damaging 1.00
R7431:Trank1 UTSW 9 111,362,402 (GRCm38) missense probably benign 0.12
R7448:Trank1 UTSW 9 111,366,349 (GRCm38) missense probably benign 0.01
R7477:Trank1 UTSW 9 111,364,957 (GRCm38) missense probably benign 0.00
R7514:Trank1 UTSW 9 111,364,756 (GRCm38) missense probably damaging 1.00
R7595:Trank1 UTSW 9 111,365,991 (GRCm38) missense probably damaging 1.00
R7637:Trank1 UTSW 9 111,365,296 (GRCm38) missense possibly damaging 0.71
R7648:Trank1 UTSW 9 111,391,685 (GRCm38) missense probably benign
R7737:Trank1 UTSW 9 111,366,012 (GRCm38) nonsense probably null
R7784:Trank1 UTSW 9 111,364,103 (GRCm38) missense probably damaging 1.00
R7884:Trank1 UTSW 9 111,392,516 (GRCm38) missense probably benign
R7912:Trank1 UTSW 9 111,391,528 (GRCm38) missense probably benign 0.04
R7938:Trank1 UTSW 9 111,365,028 (GRCm38) missense probably benign
R7979:Trank1 UTSW 9 111,377,899 (GRCm38) missense probably benign 0.00
R8064:Trank1 UTSW 9 111,352,076 (GRCm38) nonsense probably null
R8100:Trank1 UTSW 9 111,392,793 (GRCm38) missense probably damaging 1.00
R8124:Trank1 UTSW 9 111,378,927 (GRCm38) missense probably benign 0.31
R8198:Trank1 UTSW 9 111,390,812 (GRCm38) missense probably benign 0.09
R8219:Trank1 UTSW 9 111,364,909 (GRCm38) missense probably damaging 1.00
R8223:Trank1 UTSW 9 111,365,889 (GRCm38) missense probably damaging 1.00
R8316:Trank1 UTSW 9 111,349,302 (GRCm38) missense probably benign 0.38
R8436:Trank1 UTSW 9 111,391,382 (GRCm38) missense possibly damaging 0.86
R8489:Trank1 UTSW 9 111,390,275 (GRCm38) missense probably benign 0.01
R8682:Trank1 UTSW 9 111,365,344 (GRCm38) missense probably benign 0.01
R8768:Trank1 UTSW 9 111,389,276 (GRCm38) missense probably benign 0.00
R8770:Trank1 UTSW 9 111,390,824 (GRCm38) missense probably benign 0.00
R8829:Trank1 UTSW 9 111,347,523 (GRCm38) missense probably benign
R8838:Trank1 UTSW 9 111,364,905 (GRCm38) missense probably benign 0.03
R8855:Trank1 UTSW 9 111,312,221 (GRCm38) missense unknown
R8929:Trank1 UTSW 9 111,378,935 (GRCm38) missense possibly damaging 0.93
R9047:Trank1 UTSW 9 111,362,432 (GRCm38) missense probably damaging 0.99
R9090:Trank1 UTSW 9 111,345,479 (GRCm38) missense probably damaging 1.00
R9114:Trank1 UTSW 9 111,333,775 (GRCm38) missense probably damaging 1.00
R9133:Trank1 UTSW 9 111,391,702 (GRCm38) missense possibly damaging 0.93
R9177:Trank1 UTSW 9 111,392,511 (GRCm38) missense probably benign 0.00
R9178:Trank1 UTSW 9 111,367,200 (GRCm38) missense probably damaging 1.00
R9271:Trank1 UTSW 9 111,345,479 (GRCm38) missense probably damaging 1.00
R9314:Trank1 UTSW 9 111,365,981 (GRCm38) missense probably damaging 1.00
R9373:Trank1 UTSW 9 111,365,191 (GRCm38) missense probably benign 0.25
R9380:Trank1 UTSW 9 111,392,670 (GRCm38) missense probably benign 0.07
R9435:Trank1 UTSW 9 111,364,822 (GRCm38) missense probably benign 0.04
R9501:Trank1 UTSW 9 111,347,875 (GRCm38) missense probably benign 0.00
R9593:Trank1 UTSW 9 111,362,297 (GRCm38) missense probably benign 0.30
R9601:Trank1 UTSW 9 111,373,125 (GRCm38) missense probably benign 0.18
R9729:Trank1 UTSW 9 111,391,469 (GRCm38) missense probably damaging 1.00
X0064:Trank1 UTSW 9 111,343,236 (GRCm38) missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111,364,710 (GRCm38) missense probably damaging 0.99
Z1177:Trank1 UTSW 9 111,392,870 (GRCm38) missense possibly damaging 0.47
Z1177:Trank1 UTSW 9 111,367,377 (GRCm38) missense possibly damaging 0.83
Z1177:Trank1 UTSW 9 111,311,902 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- ACAACCCAGCACTGATTTGG -3'
(R):5'- ACGCCTTTCATTATGCTTTGGG -3'

Sequencing Primer
(F):5'- CCCAGCACTGATTTGGAAAGAG -3'
(R):5'- GGGCAGTGTCTCCAGTAAG -3'
Posted On 2020-09-02