Incidental Mutation 'R7449:Tchh'
ID577542
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Nametrichohyalin
SynonymsThh, AHF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7449 (G1)
Quality Score189.462
Status Not validated
Chromosome3
Chromosomal Location93442330-93449077 bp(+) (GRCm38)
Type of Mutationsmall deletion (12 aa in frame mutation)
DNA Base Change (assembly) CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC at 93446708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
Predicted Effect probably benign
Transcript: ENSMUST00000064257
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93445299 missense unknown
IGL00338:Tchh APN 3 93447644 missense unknown
IGL00541:Tchh APN 3 93446250 missense unknown
IGL02510:Tchh APN 3 93444078 missense unknown
IGL02622:Tchh APN 3 93443412 missense probably damaging 1.00
IGL03164:Tchh APN 3 93445392 missense unknown
IGL03331:Tchh APN 3 93443418 missense probably damaging 1.00
PIT4453001:Tchh UTSW 3 93445880 missense unknown
R0334:Tchh UTSW 3 93445616 missense unknown
R0603:Tchh UTSW 3 93443781 missense possibly damaging 0.91
R1186:Tchh UTSW 3 93448046 missense unknown
R1241:Tchh UTSW 3 93444972 missense unknown
R1610:Tchh UTSW 3 93444839 missense unknown
R1768:Tchh UTSW 3 93443575 missense possibly damaging 0.68
R1843:Tchh UTSW 3 93446780 missense unknown
R1866:Tchh UTSW 3 93447760 missense unknown
R1978:Tchh UTSW 3 93446799 missense unknown
R2008:Tchh UTSW 3 93445974 missense unknown
R2011:Tchh UTSW 3 93446961 missense unknown
R2087:Tchh UTSW 3 93443918 missense unknown
R2177:Tchh UTSW 3 93444132 missense unknown
R2292:Tchh UTSW 3 93442382 missense probably damaging 1.00
R2418:Tchh UTSW 3 93445629 missense unknown
R2877:Tchh UTSW 3 93444228 missense unknown
R2995:Tchh UTSW 3 93447750 small deletion probably benign
R2997:Tchh UTSW 3 93447750 small deletion probably benign
R3439:Tchh UTSW 3 93447393 missense unknown
R3440:Tchh UTSW 3 93445107 missense unknown
R3441:Tchh UTSW 3 93445107 missense unknown
R4063:Tchh UTSW 3 93446991 missense unknown
R4550:Tchh UTSW 3 93445310 missense unknown
R4720:Tchh UTSW 3 93447882 missense unknown
R4836:Tchh UTSW 3 93445148 missense unknown
R4836:Tchh UTSW 3 93447588 missense unknown
R4880:Tchh UTSW 3 93443823 missense possibly damaging 0.85
R4895:Tchh UTSW 3 93445686 missense unknown
R5188:Tchh UTSW 3 93446679 missense unknown
R5404:Tchh UTSW 3 93447675 missense unknown
R5435:Tchh UTSW 3 93443672 missense possibly damaging 0.53
R5578:Tchh UTSW 3 93444311 nonsense probably null
R5678:Tchh UTSW 3 93445626 missense unknown
R5697:Tchh UTSW 3 93445043 nonsense probably null
R5768:Tchh UTSW 3 93446181 missense unknown
R5809:Tchh UTSW 3 93445573 missense unknown
R5934:Tchh UTSW 3 93444112 missense unknown
R5945:Tchh UTSW 3 93445337 missense unknown
R6313:Tchh UTSW 3 93447851 missense unknown
R6329:Tchh UTSW 3 93446445 missense unknown
R6397:Tchh UTSW 3 93445866 missense unknown
R6818:Tchh UTSW 3 93443411 missense probably damaging 1.00
R6997:Tchh UTSW 3 93446708 small deletion probably benign
R7174:Tchh UTSW 3 93446171 missense unknown
R7268:Tchh UTSW 3 93446708 small deletion probably benign
R7270:Tchh UTSW 3 93444530 missense unknown
R7745:Tchh UTSW 3 93444777 missense unknown
Z1088:Tchh UTSW 3 93445682 nonsense probably null
Z1176:Tchh UTSW 3 93446859 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAACCGGACAGAAGATTCC -3'
(R):5'- TCACGGACTTTTCTGTCACG -3'

Sequencing Primer
(F):5'- CTGCGGGACAGTAAGATCC -3'
(R):5'- TGTCACGTTCCTGGCGC -3'
Posted On2019-10-07