Incidental Mutation 'R7449:Wdr83'
ID 577568
Institutional Source Beutler Lab
Gene Symbol Wdr83
Ensembl Gene ENSMUSG00000005150
Gene Name WD repeat domain containing 83
Synonyms 1500041N16Rik, Morg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7449 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 85075035-85081306 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85079681 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 136 (W136R)
Ref Sequence ENSEMBL: ENSMUSP00000091048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000078665] [ENSMUST00000079764] [ENSMUST00000093357] [ENSMUST00000140621] [ENSMUST00000149050] [ENSMUST00000152785] [ENSMUST00000152871] [ENSMUST00000209264] [ENSMUST00000209361]
AlphaFold Q9DAJ4
Predicted Effect probably benign
Transcript: ENSMUST00000034121
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078665
SMART Domains Protein: ENSMUSP00000077733
Gene: ENSMUSG00000060038

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:DS 44 354 7.1e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093357
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150
AA Change: W136R

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142201
Predicted Effect probably benign
Transcript: ENSMUST00000149050
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152785
AA Change: W134R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150
AA Change: W134R

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152871
SMART Domains Protein: ENSMUSP00000120308
Gene: ENSMUSG00000060038

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:DS 59 142 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-40 protein family. The protein is proposed to function as a molecular scaffold for various multimeric protein complexes. The protein associates with several components of the extracellular signal-regulated kinase (ERK) pathway, and promotes ERK activity in response to serum or other signals. The protein also interacts with egl nine homolog 3 (EGLN3, also known as PHD3) and regulates expression of hypoxia-inducible factor 1, and has been purified as part of the spliceosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality at E10.5 due to diffuse vascularization and placental insufficiency. Mice heterozygous for the same reporter allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Ago2 G A 15: 73,146,499 P30L probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Wdr83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Wdr83 APN 8 85079814 missense probably damaging 1.00
IGL01671:Wdr83 APN 8 85075819 unclassified probably benign
IGL02081:Wdr83 APN 8 85075843 missense probably benign 0.08
IGL03293:Wdr83 APN 8 85080587 missense probably benign 0.09
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R3729:Wdr83 UTSW 8 85080339 missense probably damaging 1.00
R4664:Wdr83 UTSW 8 85080051 unclassified probably benign
R4758:Wdr83 UTSW 8 85075238 missense probably benign 0.25
R5456:Wdr83 UTSW 8 85080208 missense probably benign 0.00
R6687:Wdr83 UTSW 8 85080149 missense probably benign 0.00
R7078:Wdr83 UTSW 8 85076051 missense probably damaging 1.00
R7172:Wdr83 UTSW 8 85079824 missense probably damaging 0.98
R7311:Wdr83 UTSW 8 85076261 missense probably benign 0.21
R7349:Wdr83 UTSW 8 85079831 missense possibly damaging 0.59
R7570:Wdr83 UTSW 8 85079834 missense probably damaging 1.00
R9157:Wdr83 UTSW 8 85079803 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGACATCTAGGCTGGAATTCAG -3'
(R):5'- GAGAGCCTTGCCTTAATCCCAATC -3'

Sequencing Primer
(F):5'- CATTCTGATACTCAGCACTTGGGAG -3'
(R):5'- AAGCCTCACTCCTCTAAATTGG -3'
Posted On 2019-10-07