Mutagenetix > Incidental Mutations

Incidental Mutation 'R7449:Rasgrp1'

577540

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp1

Ensembl Gene

ENSMUSG00000027347

Gene Name

RAS guanyl releasing protein 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.303) question?

Stock #

R7449 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

117279993-117343001 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117287943 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 522 (I522V)

Ref Sequence

ENSEMBL: ENSMUSP00000136423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102534
AA Change: I522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: I522V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172901
AA Change: I487V

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: I487V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000173252
AA Change: I487V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: I487V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173541
AA Change: I487V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: I487V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U\|B	705	756	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174770

SMART Domains

Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000178884
AA Change: I522V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: I522V

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Meta Mutation Damage Score

0.0955

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	A	7: 120,435,908	Y306N	possibly damaging	Het
Adgrv1	A	T	13: 81,499,073	V3116D	probably damaging	Het
Adssl1	A	T	12: 112,634,151	T185S	probably damaging	Het
Ago2	G	A	15: 73,146,499	P30L	probably damaging	Het
Atp5j	C	T	16: 84,831,363	V44M	probably benign	Het
Atp7b	T	A	8: 22,011,849	I833F	probably damaging	Het
Birc6	T	A	17: 74,702,341	N4869K	probably benign	Het
Cacna1c	C	T	6: 118,602,349	D1796N		Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cnga1	A	G	5: 72,605,304	I289T	probably benign	Het
Crybg1	C	A	10: 44,004,519	E224D	probably benign	Het
Dysf	T	C	6: 84,137,380	L1217P	possibly damaging	Het
Ebf2	T	A	14: 67,410,020	N339K	probably damaging	Het
Eva1c	T	C	16: 90,876,193		probably null	Het
Fam172a	A	G	13: 77,759,442	I41V	probably damaging	Het
Fam184a	T	C	10: 53,698,634	E293G	probably damaging	Het
Folh1	G	A	7: 86,731,748	P506S	probably benign	Het
Ftcd	A	T	10: 76,580,163	K210N	probably benign	Het
Gdf6	T	A	4: 9,844,494	V6D	possibly damaging	Het
Ghitm	C	A	14: 37,131,581	G101C	probably damaging	Het
Gimap5	T	A	6: 48,752,904	V136D	probably damaging	Het
Gm9745	T	A	13: 8,943,304	H51L	probably damaging	Het
Grm4	C	T	17: 27,435,371	G535D	probably damaging	Het
Gse1	T	C	8: 120,229,711	S314P	unknown	Het
Hnrnpdl	A	G	5: 100,037,155	I279T	probably damaging	Het
Itpr1	T	C	6: 108,389,384	S923P	probably damaging	Het
Krt39	C	A	11: 99,518,061	C303F	probably benign	Het
Lrrn1	T	C	6: 107,568,521	S427P	possibly damaging	Het
Lrrn3	T	A	12: 41,453,488	R277W	probably damaging	Het
Ltb4r1	T	C	14: 55,767,918	L226P	probably damaging	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mcoln1	T	C	8: 3,507,285	L125P	probably damaging	Het
Nid1	T	G	13: 13,482,051	V589G	probably damaging	Het
Nlrp5	T	G	7: 23,417,526	F225C	probably benign	Het
Notch3	C	T	17: 32,157,966	A322T	probably damaging	Het
Olfr299	A	G	7: 86,465,855	H148R	probably benign	Het
Olfr69	G	T	7: 103,767,819	Q193K	probably benign	Het
Olfr854	T	A	9: 19,566,866	T173S	probably benign	Het
Otogl	A	G	10: 107,803,663	C1363R	probably damaging	Het
Ovol1	T	A	19: 5,553,597	D92V	probably benign	Het
Pigt	T	C	2: 164,502,499	L356P	probably damaging	Het
Plekhg3	A	G	12: 76,566,222	Q434R	probably damaging	Het
Plekhh1	T	C	12: 79,079,552	F1344L	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Pus1	A	G	5: 110,774,586	L405P	probably damaging	Het
Qtrt2	T	A	16: 43,881,032	H55L	probably benign	Het
Raver2	T	A	4: 101,102,663	H113Q	probably damaging	Het
Recql4	T	C	15: 76,705,565	D760G	unknown	Het
Rhobtb3	C	T	13: 75,910,741	V313M	probably benign	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnf185	T	C	11: 3,426,578	Q135R	probably benign	Het
Sema3f	T	C	9: 107,684,036	S584G	probably damaging	Het
Sh3pxd2a	T	A	19: 47,267,652	T904S	probably benign	Het
Slc4a10	T	C	2: 62,303,946	V1002A	probably benign	Het
Taf1b	T	C	12: 24,504,993	I55T	probably benign	Het
Tchh	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC	3: 93,446,708		probably benign	Het
Tenm4	A	T	7: 96,874,213	D1654V	possibly damaging	Het
Tgfb1	G	A	7: 25,704,838	V357M	probably damaging	Het
Tnxb	C	T	17: 34,703,361	P2383S	possibly damaging	Het
Trpm1	A	T	7: 64,208,975	M382L	probably benign	Het
Trrap	A	G	5: 144,851,209	Y3516C	probably damaging	Het
Txnrd1	T	A	10: 82,885,233	Y494*	probably null	Het
Ubr2	C	T	17: 46,964,788	E811K	probably damaging	Het
Ubxn4	T	A	1: 128,244,543	F25I	possibly damaging	Het
Vmn2r117	A	G	17: 23,459,895	M785T	probably damaging	Het
Vmn2r99	G	A	17: 19,379,145	D364N	probably benign	Het
Vps45	C	A	3: 96,047,136		probably null	Het
Wdr25	A	C	12: 109,026,441	H426P	probably damaging	Het
Wdr83	A	T	8: 85,079,681	W136R	probably damaging	Het
Xylt1	A	C	7: 117,592,005	I343L	possibly damaging	Het
Znrd1as	A	G	17: 36,964,383	D16G	probably damaging	Het
Zscan4b	T	C	7: 10,904,058	Q53R	possibly damaging	Het

Other mutations in Rasgrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Rasgrp1	APN	2	117305791	nonsense	probably null
IGL00901:Rasgrp1	APN	2	117285130	missense	probably damaging	0.96
IGL01083:Rasgrp1	APN	2	117285068	missense	probably benign	0.22
IGL01325:Rasgrp1	APN	2	117298529	missense	probably damaging	1.00
IGL01520:Rasgrp1	APN	2	117288663	missense	probably damaging	1.00
IGL01776:Rasgrp1	APN	2	117286840	critical splice donor site	probably null
IGL01780:Rasgrp1	APN	2	117284878	missense	probably benign	0.00
IGL01859:Rasgrp1	APN	2	117289418	missense	probably benign	0.00
IGL01892:Rasgrp1	APN	2	117293842	missense	probably damaging	1.00
IGL02068:Rasgrp1	APN	2	117300578	splice site	probably benign
IGL02684:Rasgrp1	APN	2	117282576	missense	probably benign	0.03
bukhansan	UTSW	2	117291697	missense	possibly damaging	0.78
grouper	UTSW	2	117302004	nonsense	probably null
Gyeryandsan	UTSW	2	117287943	missense	probably damaging	1.00
Haddock	UTSW	2	117291895	missense	probably damaging	0.99
mercurial	UTSW	2	117287833	nonsense	probably null
naejangsan	UTSW	2	117291792	nonsense	probably null
sea_bass	UTSW	2	117282654	missense	probably benign	0.02
venutian	UTSW	2	117284929	nonsense	probably null
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0538:Rasgrp1	UTSW	2	117284947	missense	probably benign	0.42
R0786:Rasgrp1	UTSW	2	117300499	missense	probably benign
R1068:Rasgrp1	UTSW	2	117282576	missense	probably benign	0.03
R1165:Rasgrp1	UTSW	2	117284939	missense	possibly damaging	0.49
R1491:Rasgrp1	UTSW	2	117282619	nonsense	probably null
R1707:Rasgrp1	UTSW	2	117298547	missense	probably damaging	1.00
R1869:Rasgrp1	UTSW	2	117290347	missense	probably damaging	1.00
R2214:Rasgrp1	UTSW	2	117285165	missense	probably damaging	0.98
R2425:Rasgrp1	UTSW	2	117289450	critical splice acceptor site	probably null
R3236:Rasgrp1	UTSW	2	117291812	missense	probably benign	0.00
R3915:Rasgrp1	UTSW	2	117288641	missense	probably damaging	1.00
R4079:Rasgrp1	UTSW	2	117285029	missense	probably benign	0.19
R4163:Rasgrp1	UTSW	2	117282654	missense	probably benign	0.02
R4781:Rasgrp1	UTSW	2	117291709	missense	probably benign	0.04
R4782:Rasgrp1	UTSW	2	117284875	missense	probably benign	0.00
R5028:Rasgrp1	UTSW	2	117302004	nonsense	probably null
R6019:Rasgrp1	UTSW	2	117291895	missense	probably damaging	0.99
R6220:Rasgrp1	UTSW	2	117284929	nonsense	probably null
R6294:Rasgrp1	UTSW	2	117291792	nonsense	probably null
R6335:Rasgrp1	UTSW	2	117293870	missense	probably damaging	0.99
R6948:Rasgrp1	UTSW	2	117298604	missense	probably damaging	0.99
R7165:Rasgrp1	UTSW	2	117338404	missense	probably benign	0.02
R7246:Rasgrp1	UTSW	2	117338354	nonsense	probably null
R7372:Rasgrp1	UTSW	2	117285154	missense	probably benign	0.01
R7400:Rasgrp1	UTSW	2	117298545	missense	probably damaging	1.00
R7432:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117291697	missense	possibly damaging	0.78
R7450:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7475:Rasgrp1	UTSW	2	117286108	missense	probably benign
R7487:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7573:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7672:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R8016:Rasgrp1	UTSW	2	117287833	nonsense	probably null
R8199:Rasgrp1	UTSW	2	117293812	missense	probably damaging	1.00
R8527:Rasgrp1	UTSW	2	117338304	missense	probably benign	0.07
Z1176:Rasgrp1	UTSW	2	117301974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGATTTTGAGGCCATGACTG -3'
(R):5'- CCCTTTTGAGTCTCGAGCAC -3'

Sequencing Primer
(F):5'- TGAGGCCATGACTGTTTTACTAG -3'
(R):5'- TTTTGAGTCTCGAGCACACACAC -3'

Posted On

2019-10-07