Incidental Mutation 'R7449:Ago2'
ID577596
Institutional Source Beutler Lab
Gene Symbol Ago2
Ensembl Gene ENSMUSG00000036698
Gene Nameargonaute RISC catalytic subunit 2
Synonyms2310051F07Rik, argonaute 2, Eif2c2, 1110029L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7449 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location73095844-73184935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73146499 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 30 (P30L)
Ref Sequence ENSEMBL: ENSMUSP00000042207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044113]
Predicted Effect probably damaging
Transcript: ENSMUST00000044113
AA Change: P30L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042207
Gene: ENSMUSG00000036698
AA Change: P30L

DomainStartEndE-ValueType
Pfam:ArgoN 29 167 1.7e-29 PFAM
DUF1785 176 228 2.98e-24 SMART
PAZ 236 371 3.11e-4 SMART
Pfam:ArgoL2 376 421 8.7e-16 PFAM
Pfam:ArgoMid 430 512 2.9e-35 PFAM
Piwi 518 819 1.36e-135 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, and contains a PAZ domain and a PIWI domain. It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality with neural tube defects, abnormal forebrain patterning, enlarged hearts, pericardial swelling, delayed development, and defects in the yolk sac and placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T A 7: 120,435,908 Y306N possibly damaging Het
Adgrv1 A T 13: 81,499,073 V3116D probably damaging Het
Adssl1 A T 12: 112,634,151 T185S probably damaging Het
Atp5j C T 16: 84,831,363 V44M probably benign Het
Atp7b T A 8: 22,011,849 I833F probably damaging Het
Birc6 T A 17: 74,702,341 N4869K probably benign Het
Cacna1c C T 6: 118,602,349 D1796N Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cnga1 A G 5: 72,605,304 I289T probably benign Het
Crybg1 C A 10: 44,004,519 E224D probably benign Het
Dysf T C 6: 84,137,380 L1217P possibly damaging Het
Ebf2 T A 14: 67,410,020 N339K probably damaging Het
Eva1c T C 16: 90,876,193 probably null Het
Fam172a A G 13: 77,759,442 I41V probably damaging Het
Fam184a T C 10: 53,698,634 E293G probably damaging Het
Folh1 G A 7: 86,731,748 P506S probably benign Het
Ftcd A T 10: 76,580,163 K210N probably benign Het
Gdf6 T A 4: 9,844,494 V6D possibly damaging Het
Ghitm C A 14: 37,131,581 G101C probably damaging Het
Gimap5 T A 6: 48,752,904 V136D probably damaging Het
Gm9745 T A 13: 8,943,304 H51L probably damaging Het
Grm4 C T 17: 27,435,371 G535D probably damaging Het
Gse1 T C 8: 120,229,711 S314P unknown Het
Hnrnpdl A G 5: 100,037,155 I279T probably damaging Het
Itpr1 T C 6: 108,389,384 S923P probably damaging Het
Krt39 C A 11: 99,518,061 C303F probably benign Het
Lrrn1 T C 6: 107,568,521 S427P possibly damaging Het
Lrrn3 T A 12: 41,453,488 R277W probably damaging Het
Ltb4r1 T C 14: 55,767,918 L226P probably damaging Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mcoln1 T C 8: 3,507,285 L125P probably damaging Het
Nid1 T G 13: 13,482,051 V589G probably damaging Het
Nlrp5 T G 7: 23,417,526 F225C probably benign Het
Notch3 C T 17: 32,157,966 A322T probably damaging Het
Olfr299 A G 7: 86,465,855 H148R probably benign Het
Olfr69 G T 7: 103,767,819 Q193K probably benign Het
Olfr854 T A 9: 19,566,866 T173S probably benign Het
Otogl A G 10: 107,803,663 C1363R probably damaging Het
Ovol1 T A 19: 5,553,597 D92V probably benign Het
Pigt T C 2: 164,502,499 L356P probably damaging Het
Plekhg3 A G 12: 76,566,222 Q434R probably damaging Het
Plekhh1 T C 12: 79,079,552 F1344L probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Pus1 A G 5: 110,774,586 L405P probably damaging Het
Qtrt2 T A 16: 43,881,032 H55L probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Raver2 T A 4: 101,102,663 H113Q probably damaging Het
Recql4 T C 15: 76,705,565 D760G unknown Het
Rhobtb3 C T 13: 75,910,741 V313M probably benign Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rnf185 T C 11: 3,426,578 Q135R probably benign Het
Sema3f T C 9: 107,684,036 S584G probably damaging Het
Sh3pxd2a T A 19: 47,267,652 T904S probably benign Het
Slc4a10 T C 2: 62,303,946 V1002A probably benign Het
Taf1b T C 12: 24,504,993 I55T probably benign Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tenm4 A T 7: 96,874,213 D1654V possibly damaging Het
Tgfb1 G A 7: 25,704,838 V357M probably damaging Het
Tnxb C T 17: 34,703,361 P2383S possibly damaging Het
Trpm1 A T 7: 64,208,975 M382L probably benign Het
Trrap A G 5: 144,851,209 Y3516C probably damaging Het
Txnrd1 T A 10: 82,885,233 Y494* probably null Het
Ubr2 C T 17: 46,964,788 E811K probably damaging Het
Ubxn4 T A 1: 128,244,543 F25I possibly damaging Het
Vmn2r117 A G 17: 23,459,895 M785T probably damaging Het
Vmn2r99 G A 17: 19,379,145 D364N probably benign Het
Vps45 C A 3: 96,047,136 probably null Het
Wdr25 A C 12: 109,026,441 H426P probably damaging Het
Wdr83 A T 8: 85,079,681 W136R probably damaging Het
Xylt1 A C 7: 117,592,005 I343L possibly damaging Het
Znrd1as A G 17: 36,964,383 D16G probably damaging Het
Zscan4b T C 7: 10,904,058 Q53R possibly damaging Het
Other mutations in Ago2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ago2 APN 15 73126453 missense probably benign 0.00
IGL01642:Ago2 APN 15 73123390 missense probably benign 0.00
IGL02017:Ago2 APN 15 73126517 missense probably benign 0.15
IGL02246:Ago2 APN 15 73108418 missense probably damaging 1.00
IGL02434:Ago2 APN 15 73121081 missense probably damaging 1.00
IGL02674:Ago2 APN 15 73111794 missense probably damaging 1.00
IGL02686:Ago2 APN 15 73113742 missense possibly damaging 0.95
IGL02716:Ago2 APN 15 73111727 missense possibly damaging 0.94
IGL02751:Ago2 APN 15 73130897 missense possibly damaging 0.76
IGL02973:Ago2 APN 15 73123465 splice site probably benign
IGL03188:Ago2 APN 15 73123333 missense probably benign
PIT4791001:Ago2 UTSW 15 73121240 missense possibly damaging 0.72
R0316:Ago2 UTSW 15 73130876 missense probably damaging 0.99
R1382:Ago2 UTSW 15 73127040 missense probably benign 0.35
R1509:Ago2 UTSW 15 73116364 missense probably damaging 1.00
R1802:Ago2 UTSW 15 73121180 missense probably damaging 1.00
R1848:Ago2 UTSW 15 73123965 missense probably benign 0.02
R1930:Ago2 UTSW 15 73119355 missense probably damaging 0.97
R2195:Ago2 UTSW 15 73119469 missense probably benign 0.15
R2219:Ago2 UTSW 15 73146411 missense probably benign
R2350:Ago2 UTSW 15 73119461 missense probably benign 0.01
R2517:Ago2 UTSW 15 73124242 missense possibly damaging 0.76
R3727:Ago2 UTSW 15 73113857 missense probably damaging 1.00
R4614:Ago2 UTSW 15 73130967 missense probably damaging 0.98
R4667:Ago2 UTSW 15 73146416 missense probably damaging 1.00
R5101:Ago2 UTSW 15 73119490 missense probably damaging 0.99
R5175:Ago2 UTSW 15 73124218 missense possibly damaging 0.57
R5751:Ago2 UTSW 15 73128323 critical splice donor site probably null
R5815:Ago2 UTSW 15 73107366 critical splice acceptor site probably null
R6166:Ago2 UTSW 15 73124240 missense probably benign 0.00
R6378:Ago2 UTSW 15 73123925 missense probably benign
R6572:Ago2 UTSW 15 73126977 missense probably benign 0.14
R6922:Ago2 UTSW 15 73113752 missense probably benign 0.39
R7068:Ago2 UTSW 15 73146450 missense probably damaging 1.00
R7447:Ago2 UTSW 15 73138032 missense probably benign 0.35
X0012:Ago2 UTSW 15 73106952 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACATCCTAACAACTTCCTGGG -3'
(R):5'- AAGTCCCCAGCAGAGGAATC -3'

Sequencing Primer
(F):5'- TGGGACAGGGTCAGAAGATACC -3'
(R):5'- CTCTCTTGGTGATCTGGAAGAACAAG -3'
Posted On2019-10-07